LXL04_029100 | RubberDandelionOmics

Gene overview

LXL04_029100

Reference: OH-1004 Chr: Chr06 Coordinates: 80874675-80876595 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

855 bp · LXL04_029100|LXL04_029100|OH1004|cDNA

ATGTCTCGCTTAATTCATTCCAGAATATCGCTCTCCAGATTCTCCAATACATGGGGTTCAGTTGGAAGAGGGAGATACTTTTCAACAGAATCTAACAAGATTGACGAACCACTTAAAGTACAGGAAGCTGAAACAATAaatcctccaccacctccaGAAGAAAAGTTACTTGTACTTGGTGGAAATGGGTTTGTTGGCTCGCACATATGCAAAGAAGCTTTGGACCGTGGCTTGTCAGTTGCAAGTCTTAGCAGATCCGG...

CDS

Download CDS FASTA

855 bp · LXL04_029100|LXL04_029100|OH1004|CDS

ATGTCTCGCTTAATTCATTCCAGAATATCGCTCTCCAGATTCTCCAATACATGGGGTTCAGTTGGAAGAGGGAGATACTTTTCAACAGAATCTAACAAGATTGACGAACCACTTAAAGTACAGGAAGCTGAAACAATAAATCCTCCACCACCTCCAGAAGAAAAGTTACTTGTACTTGGTGGAAATGGGTTTGTTGGCTCGCACATATGCAAAGAAGCTTTGGACCGTGGCTTGTCAGTTGCAAGTCTTAGCAGATCCGG...

Protein

Download Protein FASTA

284 aa · LXL04_029100|LXL04_029100|OH1004|PROTEIN

MSRLIHSRISLSRFSNTWGSVGRGRYFSTESNKIDEPLKVQEAETINPPPPPEEKLLVLGGNGFVGSHICKEALDRGLSVASLSRSGKSSIQDPWATKVSWHKGDLLSGDSWKEALTGVTSVISCVGGFGSNTFMYKINGTANINAIRAAAEKGIKRFVYISASDFGVINYLLQGYYDGKRATETELLTRFPYGHVILRPGFIYGTRRVGSMKLPLGVIGSPLEMVMQYAKPLSQVPVIGPLLTPPVDVKAVAKVAVRGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029100`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029100

Location Chr06:80874675-80876595 (-)

Description Similar to At1g32220: Uncharacterized protein At1g32220, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32220`	Uncharacterized protein At1g32220, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029100 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006695 cholesterol biosynthetic process Biological Process

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0008203 cholesterol metabolic process Biological Process

GO:0015979 photosynthesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G32220

bta:616694

sce:YLR290C

spo:2538806

syn:slr0399

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.937

Rank 1 · LXL04_029100 · OH-1004

Cytoplasm0.074

Rank 2 · LXL04_029100 · OH-1004

Nucleus0.052

Rank 3 · LXL04_029100 · OH-1004

Plastid0.039

Rank 4 · LXL04_029100 · OH-1004

Cell membrane0.030

Rank 5 · LXL04_029100 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368.20NmrA53-162 aa

PF01370.28Epimerase57-164 aa

PF01073.263Beta_HSD57-187 aa

PF13460.13NAD_binding_1060-204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029100	`PF05368.20`	NmrA	53	162	3e-09	37.6
LXL04_029100	`PF01370.28`	Epimerase	57	164	3.4e-13	50.3
LXL04_029100	`PF01073.26`	3Beta_HSD	57	187	1.8e-10	41.0
LXL04_029100	`PF13460.13`	NAD_binding_10	60	204	3.1e-18	67.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FVR6`	Arabidopsis thaliana	Uncharacterized protein At1g32220, chloroplastic	41.935%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card