LXL04_028465 | RubberDandelionOmics

Gene overview

LXL04_028465

Reference: OH-1004 Chr: Chr06 Coordinates: 42652481-42655294 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1023 bp · LXL04_028465|LXL04_028465|OH1004|cDNA

atgtatgtcataagAAAATGTCATCTGTCTCATGAATTTGAAGGACAGatgacatacttaaatAAAGCATTGAAGATccagttcttcttcttcgcgaggcAGAGAACTCCTGCGAGTTCCCAGCGATTTCAGATCCCGGCGAGTGGAGTACGAGGCAGAGCGACCATCGACAAGGAGAGCCGTCCGGAGGAAGACTCGTGCAGCAACGCGAAGAAGAACCAGGGTACAGAACACTTCATCTCCCCCGAGCCCGAACACTT...

CDS

Download CDS FASTA

1023 bp · LXL04_028465|LXL04_028465|OH1004|CDS

ATGTATGTCATAAGAAAATGTCATCTGTCTCATGAATTTGAAGGACAGATGACATACTTAAATAAAGCATTGAAGATCCAGTTCTTCTTCTTCGCGAGGCAGAGAACTCCTGCGAGTTCCCAGCGATTTCAGATCCCGGCGAGTGGAGTACGAGGCAGAGCGACCATCGACAAGGAGAGCCGTCCGGAGGAAGACTCGTGCAGCAACGCGAAGAAGAACCAGGGTACAGAACACTTCATCTCCCCCGAGCCCGAACACTT...

Protein

Download Protein FASTA

340 aa · LXL04_028465|LXL04_028465|OH1004|PROTEIN

MYVIRKCHLSHEFEGQMTYLNKALKIQFFFFARQRTPASSQRFQIPASGVRGRATIDKESRPEEDSCSNAKKNQGTEHFISPEPEHFISPAATPTFKLNAGNMNCDGRISRSSYLGFHTQHTYGSPLPANGDSVRRRCSVLQWHPDFATQLIVASDDDSSPSLRQLSSDNTKSSESHLIHPFLQAYLDQHLQLPISQESEYTKVLESVYIYDTINEIDNRMRFYDSSKGGSLNQDFVSKIADLLPSINEYARLFKTSKEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028465`
TK1151 ID	TkA05G428420
OH-1004 ID	LXL04_028465
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	98.700
Protein coverage (%)	TK1151 75.490 / OH-1004 22.353 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028465

Location Chr06:42652481-42655294 (+)

Description Similar to SEC31B: Protein transport protein SEC31 homolog B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63460`	Required for protein transport from the endoplasmic reticulum to the Golgi apparatus.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028465 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0015031 protein transport Biological Process

GO:0090110 COPII-coated vesicle cargo loading Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0030127 COPII vesicle coat Cellular Component

GO:0070971 endoplasmic reticulum exit site Cellular Component

GO:0005198 structural molecule activity Molecular Function

KEGG gene cross-reference

ath:AT3G63460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.880

Rank 1 · LXL04_028465 · OH-1004

Cytoplasm0.211

Rank 2 · LXL04_028465 · OH-1004

Mitochondrion0.033

Rank 3 · LXL04_028465 · OH-1004

Cell membrane0.022

Rank 4 · LXL04_028465 · OH-1004

Endoplasmic reticulum0.014

Rank 5 · LXL04_028465 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L611`	Arabidopsis thaliana	Protein transport protein SEC31 homolog B	62.791%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card