LXL04_028128 | RubberDandelionOmics

Gene overview

LXL04_028128

Reference: OH-1004 Chr: Chr06 Coordinates: 31984703-31991752 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2505 bp · LXL04_028128|LXL04_028128|OH1004|cDNA

ATGTTGGTGATACGAAAGAGATGCATATGGTTTTCTTGTGAGGCCTCAGCATGTACAGAGAATGAGAAATGGAAAGGGCAGATTGAGAAGGACTTGCCTCGAACATTTCCAGGTCATCCTGCTTTGGATGATGATGGCAGGAATGCTTTGAGACGTTTACTCACTGCTTATGCTAGACATAACCCCTCTGTTGGCTATTGCCAGAAATTCATGTGCAGAAGATACTATTGGGACAAAGTGGAACAGGAAGCTTTTCTTCT...

CDS

Download CDS FASTA

2505 bp · LXL04_028128|LXL04_028128|OH1004|CDS

ATGTTGGTGATACGAAAGAGATGCATATGGTTTTCTTGTGAGGCCTCAGCATGTACAGAGAATGAGAAATGGAAAGGGCAGATTGAGAAGGACTTGCCTCGAACATTTCCAGGTCATCCTGCTTTGGATGATGATGGCAGGAATGCTTTGAGACGTTTACTCACTGCTTATGCTAGACATAACCCCTCTGTTGGCTATTGCCAGAAATTCATGTGCAGAAGATACTATTGGGACAAAGTGGAACAGGAAGCTTTTCTTCT...

Protein

Download Protein FASTA

834 aa · LXL04_028128|LXL04_028128|OH1004|PROTEIN

MLVIRKRCIWFSCEASACTENEKWKGQIEKDLPRTFPGHPALDDDGRNALRRLLTAYARHNPSVGYCQKFMCRRYYWDKVEQEAFLLFTWSFGLLRGKLNKRHVFMTKSTAGQQNQLVKKGSAGIANDQQNSLMNDCIRIRKNRIKCHHNYQGKFRNFGPWMYFCWFDYWQLFKEFKTGLLRVFFWDAAAFRSCWGYLLQLRFLMYGQNWKKPVAGIDYCYWNHRLLMLDKGQFRLFNADRGWGCKWRLLLRFKRGRNYA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028128`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028128

Location Chr06:31984703-31991752 (-)

Description Similar to ISCA: Iron-sulfur assembly protein IscA, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10500`	Involved in the assembly of chloroplastic iron-sulfur proteins.	Iron-sulfur cluster biogenesis in chloroplasts. Involvement of the scaffold protein CpIscA.2005 · DOI: 10.1104/pp.104.058602

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028128 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016226 iron-sulfur cluster assembly Biological Process

GO:0051604 protein maturation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0005506 iron ion binding Molecular Function

GO:0030674 protein-macromolecule adaptor activity Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051536 iron-sulfur cluster binding Molecular Function

GO:0051537 2 iron, 2 sulfur cluster binding Molecular Function

KEGG gene cross-reference

ath:AT1G10500

syn:slr1417

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.518

Rank 1 · LXL04_028128 · OH-1004

Cytoplasm0.455

Rank 2 · LXL04_028128 · OH-1004

Cell membrane0.086

Rank 3 · LXL04_028128 · OH-1004

Endoplasmic reticulum0.083

Rank 4 · LXL04_028128 · OH-1004

Mitochondrion0.066

Rank 5 · LXL04_028128 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00566.26RabGAP-TBC21-69 aa

PF00566.26RabGAP-TBC467-516 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028128	`PF00566.26`	RabGAP-TBC	21	69	4.8e-24	85.9
LXL04_028128	`PF00566.26`	RabGAP-TBC	467	516	4.8e-24	85.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XIK3`	Arabidopsis thaliana	Iron-sulfur assembly protein IscA, chloroplastic	70.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card