LXL04_027644 | RubberDandelionOmics

Gene overview

LXL04_027644

Reference: OH-1004 Chr: Chr06 Coordinates: 20982017-20994624 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6945 bp · LXL04_027644|LXL04_027644|OH1004|cDNA

GATTTGTTGATTAAGAAATGTGTGCCATGTGACAAGAAGGATTTGAGCCCAATGATGGAGGAAACTGTCAATAGGTTTAAACTCCAGGTGCCGAAAGGGGAGTTGGTAAAGGGTGATTATGGTGTAACGAAGCTGCGTAGGAAATTTAAAGTCAAGACTTTCCTTCAAGGATTGGAGTTATTTAAGATTGTTGCTAACTTGGCTCAGTATGAAGATCATTATCCAGATCTACATATTGTCGAAACTCTCAACGTGACAAT...

CDS

Download CDS FASTA

6942 bp · LXL04_027644|LXL04_027644|OH1004|CDS

TTGTTGATTAAGAAATGTGTGCCATGTGACAAGAAGGATTTGAGCCCAATGATGGAGGAAACTGTCAATAGGTTTAAACTCCAGGTGCCGAAAGGGGAGTTGGTAAAGGGTGATTATGGTGTAACGAAGCTGCGTAGGAAATTTAAAGTCAAGACTTTCCTTCAAGGATTGGAGTTATTTAAGATTGTTGCTAACTTGGCTCAGTATGAAGATCATTATCCAGATCTACATATTGTCGAAACTCTCAACGTGACAATCGA...

Protein

Download Protein FASTA

2313 aa · LXL04_027644|LXL04_027644|OH1004|PROTEIN

MLIKKCVPCDKKDLSPMMEETVNRFKLQVPKGELVKGDYGVTKLRRKFKVKTFLQGLELFKIVANLAQYEDHYPDLHIVETLNVTIELCTHACGKNYLLVKQFSTFSKVNLEILSSFFLLTCFLVFLELVSERVRQGRCSSISLSFLIGLIKEVGAVKKKTRKTMALAREGGQMAYQVPVLTPINYPVWAVKVKSIMDAHGIWETVDVRVLGEEADPKKKKQALAFLFQEEMVLQMASYTDPKQVWDGLKTRYLGVDRVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027644`
TK1151 ID	TkA07G082700
OH-1004 ID	LXL04_027644
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	95.700
Protein coverage (%)	TK1151 77.049 / OH-1004 4.064 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027644

Location Chr06:20982017-20994624 (-)

Description Similar to PDL2: Pterin-4-alpha-carbinolamine dehydratase 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29810`	Involved in tetrahydrobiopterin biosynthesis (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027644 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006729 tetrahydrobiopterin biosynthetic process Biological Process

GO:0015074 DNA integration Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0008124 4-alpha-hydroxytetrahydrobiopterin dehydratase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G29810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.595

Rank 1 · LXL04_027644 · OH-1004

Cytoplasm0.514

Rank 2 · LXL04_027644 · OH-1004

Mitochondrion0.069

Rank 3 · LXL04_027644 · OH-1004

Endoplasmic reticulum0.046

Rank 4 · LXL04_027644 · OH-1004

Cell membrane0.041

Rank 5 · LXL04_027644 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01329.25Pterin_4a42-94 aa

PF13961.13DUF4219185-206 aa

PF14223.15Retrotran_gag_2197-356 aa

PF00098.29zf-CCHC417-433 aa

PF13961.13DUF4219500-521 aa

PF14223.15Retrotran_gag_2510-674 aa

PF00098.29zf-CCHC735-751 aa

PF14223.15Retrotran_gag_2791-933 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027644	`PF01329.25`	Pterin_4a	42	94	2.6e-08	34.6
LXL04_027644	`PF13961.13`	DUF4219	185	206	5.2e-40	135.1
LXL04_027644	`PF14223.15`	Retrotran_gag_2	197	356	1.2e-140	465.2
LXL04_027644	`PF00098.29`	zf-CCHC	417	433	4.8e-30	103.0
LXL04_027644	`PF13961.13`	DUF4219	500	521	5.2e-40	135.1
LXL04_027644	`PF14223.15`	Retrotran_gag_2	510	674	1.2e-140	465.2
LXL04_027644	`PF00098.29`	zf-CCHC	735	751	4.8e-30	103.0
LXL04_027644	`PF14223.15`	Retrotran_gag_2	791	933	1.2e-140	465.2
LXL04_027644	`PF00098.29`	zf-CCHC	994	1010	4.8e-30	103.0
LXL04_027644	`PF13961.13`	DUF4219	1077	1098	5.2e-40	135.1
LXL04_027644	`PF14223.15`	Retrotran_gag_2	1087	1251	1.2e-140	465.2
LXL04_027644	`PF00098.29`	zf-CCHC	1312	1328	4.8e-30	103.0
LXL04_027644	`PF13961.13`	DUF4219	1395	1416	5.2e-40	135.1
LXL04_027644	`PF14223.15`	Retrotran_gag_2	1405	1569	1.2e-140	465.2
LXL04_027644	`PF00098.29`	zf-CCHC	1630	1646	4.8e-30	103.0
LXL04_027644	`PF13961.13`	DUF4219	1713	1734	5.2e-40	135.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6QJ72`	Arabidopsis thaliana	Pterin-4-alpha-carbinolamine dehydratase 2, mitochondrial	46.154%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card