LXL04_027643 | RubberDandelionOmics

Gene overview

LXL04_027643

Reference: OH-1004 Chr: Chr06 Coordinates: 20941657-20942813 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

609 bp · LXL04_027643|LXL04_027643|OH1004|cDNA

ATGGCATTCTTAAAACAAAATGTAGAACTTTTACATGTAAAttcagatatatttatgtttgaTGTTTCTTGTCTGTAGGAGTCTTGCCCTTCAGTGAAGAACATTTTACTTTTGGATTCAGAAGGATGTCGTGTAGCTGTGAAATACTATTCAGATGACTGGCCAACTAATAGTTCTAAAGAAGCATTTGAAAAGTCTGTGTTTACCAAGACTCAGAAGACAAATGCACGAACAGAATCTGAAATAACAATGTTTGAGAA...

CDS

Download CDS FASTA

498 bp · LXL04_027643|LXL04_027643|OH1004|CDS

TTGGATTCAGAAGGATGTCGTGTAGCTGTGAAATACTATTCAGATGACTGGCCAACTAATAGTTCTAAAGAAGCATTTGAAAAGTCTGTGTTTACCAAGACTCAGAAGACAAATGCACGAACAGAATCTGAAATAACAATGTTTGAGAACAATATCATCATCTACAAATTTGCTCAAGATCTTCACTTCTTTGTTACTGGTGGTGATGATGAAAATGAGCTCATTATATCCACAGTTCTTCAGGGTTTCTTTGATGCAGT...

Protein

Download Protein FASTA

165 aa · LXL04_027643|LXL04_027643|OH1004|PROTEIN

MDSEGCRVAVKYYSDDWPTNSSKEAFEKSVFTKTQKTNARTESEITMFENNIIIYKFAQDLHFFVTGGDDENELIISTVLQGFFDAVGLLLRGNVDKKEALENLDLILLCLDEIVDGGIILETDANVIAGKVASHSVDSGAPLSEQTISQALATAREHLTRSLLK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027643`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027643

Location Chr06:20941657-20942813 (-)

Description Similar to COPZ2: Coatomer subunit zeta-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g60970`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release
`At4g08520`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release
`At3g09800`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0317400`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release
`Os05g0461000`	The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027643 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0030126 COPI vesicle coat Cellular Component

KEGG gene cross-reference

ath:AT1G60970

ath:AT3G09800

ath:AT4G08520

dosa:Os02g0317400

dosa:Os05g0461000

osa:4329152

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.472

Rank 1 · LXL04_027643 · OH-1004

Golgi apparatus0.369

Rank 2 · LXL04_027643 · OH-1004

Lysosome / Vacuole0.249

Rank 3 · LXL04_027643 · OH-1004

Nucleus0.185

Rank 4 · LXL04_027643 · OH-1004

Cell membrane0.121

Rank 5 · LXL04_027643 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01217.27Clat_adaptor_s3-133 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027643	`PF01217.27`	Clat_adaptor_s	3	133	2e-20	73.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940S5`	Arabidopsis thaliana	Coatomer subunit zeta-1	78.788%	Swiss-Prot	strong database homology
`Q8H1F4`	Arabidopsis thaliana	Coatomer subunit zeta-3	76.220%	Swiss-Prot	strong database homology
`Q84LG4`	Arabidopsis thaliana	Coatomer subunit zeta-2	75.000%	Swiss-Prot	strong database homology
`Q6Z844`	Oryza sativa subsp. japonica	Coatomer subunit zeta-2	78.788%	Swiss-Prot	strong database homology
`Q9MAX5`	Oryza sativa subsp. japonica	Coatomer subunit zeta-1	70.122%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card