Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1932 bp · LXL04_027377|LXL04_027377|OH1004|cDNA
ATGGCGGAATCAAGTGTGGAGACGAACGCCACGCCTACGACTAGACCACAAGCAAGACGGCTGAAAGGCCATAAAGACATCGCTACCTGCTGTATTGCTTCCCGCGACCGCCCTGGCCTCATCGCCTCTTCATCGGAGGATGGGTGTATTTGCTGGTTTGATATGCGATGTAAAGATCTTTTATTTACCATGGATGTTGCTCAAAATCCTATTTCCTCATTATGCTTCAAACCAGGGAATGAGGATATTATATACGTTTC...
1932 bp · LXL04_027377|LXL04_027377|OH1004|CDS
ATGGCGGAATCAAGTGTGGAGACGAACGCCACGCCTACGACTAGACCACAAGCAAGACGGCTGAAAGGCCATAAAGACATCGCTACCTGCTGTATTGCTTCCCGCGACCGCCCTGGCCTCATCGCCTCTTCATCGGAGGATGGGTGTATTTGCTGGTTTGATATGCGATGTAAAGATCTTTTATTTACCATGGATGTTGCTCAAAATCCTATTTCCTCATTATGCTTCAAACCAGGGAATGAGGATATTATATACGTTTC...
Protein
Download Protein FASTA643 aa · LXL04_027377|LXL04_027377|OH1004|PROTEIN
MAESSVETNATPTTRPQARRLKGHKDIATCCIASRDRPGLIASSSEDGCICWFDMRCKDLLFTMDVAQNPISSLCFKPGNEDIIYVSSENEVKVLDVHMLASWKPLESFNYNKEEINQITCNSKSSFLAAADDGGDIKIIDIGQKCLYKTLRAAHQSICSSVQFLPWRPWEVITGGLDSKLIMWDFSKGRPFKVMDLGKSDPESSSSGSQCFNPAFVHAIAVPEVDMLERLDKICVVARGDGVVDVINIESQFKPRESGQ...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_027377 |
|---|---|
| TK1151 ID | TkA07G053500 |
| OH-1004 ID | LXL04_027377 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 96.300 |
| Protein coverage (%) | TK1151 99.518 / OH-1004 95.801Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_027377 |
|---|---|
| Location | Chr06:14461250-14471624 (+) |
| Description | Similar to WDR53: WD repeat-containing protein 53 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000132 establishment of mitotic spindle orientation Biological Process GO:0007097 nuclear migration Biological Process GO:0007281 germ cell development Biological Process GO:0031023 microtubule organizing center organization Biological Process GO:0047496 vesicle transport along microtubule Biological Process GO:0051012 microtubule sliding Biological Process GO:0051225 spindle assembly Biological Process GO:0051299 centrosome separation Biological Process GO:0051301 cell division Biological Process GO:0000776 kinetochore Cellular Component GO:0005635 nuclear envelope Cellular Component GO:0005813 centrosome Cellular Component |
| KEGG gene cross-reference | bta:518441 ddi:DDB_G0293608 hsa:348793 isc:8030493 mmu:68980 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25174.2Beta-prop_THOC317-190 aaPF25175.2Beta-prop_WDR518-98 aaPF25173.2Beta-prop_WDR3_1st18-96 aaPF23381.2Beta-prop_IFT122_1st18-192 aaPF25047.1Beta-prop_TEP1_2nd22-143 aaPF24807.2WD40_CDC20-Fz25-198 aaPF24814.2WD40_Prp1929-190 aaPF23414.2Beta-prop_EML_239-158 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_027377 | PF25174.2 | Beta-prop_THOC3 | 17 | 190 | 2.1e-23 | 83.4 |
| LXL04_027377 | PF25175.2 | Beta-prop_WDR5 | 18 | 98 | 1.5e-22 | 81.0 |
| LXL04_027377 | PF25173.2 | Beta-prop_WDR3_1st | 18 | 96 | 1.4e-20 | 74.5 |
| LXL04_027377 | PF23381.2 | Beta-prop_IFT122_1st | 18 | 192 | 5.6e-16 | 59.4 |
| LXL04_027377 | PF25047.1 | Beta-prop_TEP1_2nd | 22 | 143 | 8.5e-11 | 42.2 |
| LXL04_027377 | PF24807.2 | WD40_CDC20-Fz | 25 | 198 | 4.7e-18 | 66.2 |
| LXL04_027377 | PF24814.2 | WD40_Prp19 | 29 | 190 | 3.3e-13 | 50.1 |
| LXL04_027377 | PF23414.2 | Beta-prop_EML_2 | 39 | 158 | 7.8e-11 | 42.6 |
| LXL04_027377 | PF23409.2 | Beta-prop_EML | 42 | 187 | 7.5e-08 | 32.9 |
| LXL04_027377 | PF25171.2 | Beta-prop_WDR36-Utp21_1st | 45 | 186 | 8.2e-12 | 45.8 |
| LXL04_027377 | PF24796.2 | WDR55 | 71 | 192 | 2.5e-10 | 40.6 |
| LXL04_027377 | PF25168.2 | Beta-prop_WDR36-Utp21_2nd | 82 | 190 | 6.4e-12 | 46.1 |
| LXL04_027377 | PF25175.2 | Beta-prop_WDR5 | 98 | 196 | 1.5e-22 | 81.0 |
| LXL04_027377 | PF25173.2 | Beta-prop_WDR3_1st | 108 | 192 | 1.4e-20 | 74.5 |
| LXL04_027377 | PF24817.2 | WD40_WDHD1_1st | 112 | 224 | 2.7e-16 | 60.4 |
| LXL04_027377 | PF00400.39 | WD40 | 296 | 330 | 4.7e-17 | 62.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.