Gene Card
Gene overview
cDNA / CDS / Protein Sequences
774 bp · LXL04_025736|LXL04_025736|OH1004|cDNA
atgtttgttttttggaagaGGAAAGACCCAAAAACCTCTGCCCGCGGTCTGCTTGTCGCGTCTTCATCACCGATCGTCGTCTTCATCGCCGATCGTCCTCTCCTCCATCGCGATTCAACAGCCGCTGCACCAAGCGATTCAATTTCTGCCGATTTCACTCCGATTTCACCCGATTTCTTCACTACAAACACAGAGATGGAATTGCATGATAAAAACCACGATGGATTAGTTTCTTTTGCTGAATACCAGCCTCCCACTTG...
774 bp · LXL04_025736|LXL04_025736|OH1004|CDS
ATGTTTGTTTTTTGGAAGAGGAAAGACCCAAAAACCTCTGCCCGCGGTCTGCTTGTCGCGTCTTCATCACCGATCGTCGTCTTCATCGCCGATCGTCCTCTCCTCCATCGCGATTCAACAGCCGCTGCACCAAGCGATTCAATTTCTGCCGATTTCACTCCGATTTCACCCGATTTCTTCACTACAAACACAGAGATGGAATTGCATGATAAAAACCACGATGGATTAGTTTCTTTTGCTGAATACCAGCCTCCCACTTG...
Protein
Download Protein FASTA257 aa · LXL04_025736|LXL04_025736|OH1004|PROTEIN
MFVFWKRKDPKTSARGLLVASSSPIVVFIADRPLLHRDSTAAAPSDSISADFTPISPDFFTTNTEMELHDKNHDGLVSFAEYQPPTWVRDSVSTDYNVRRFLSVGNFCNCFQHPPDTQNPRLLKWLCKEEVRERDSDKDGKVNFKEFFHGLFDLVRNYDEDGHNSSHESGDSLESPARTFFAQLDKDGDGFLSDVEMLSIIGKLHPSERYYAKQQADYIISQADTDKDGRLSLTEMIESPYVFYSAIFNEDEDEDYE
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_025736 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_025736 |
|---|---|
| Location | Chr05:116114553-116115992 (-) |
| Description | Protein of unknown function |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0009966 regulation of signal transduction Biological Process GO:0019722 calcium-mediated signaling Biological Process GO:1902848 negative regulation of neuronal signal transduction Biological Process GO:0016020 membrane Cellular Component GO:0003779 actin binding Molecular Function GO:0005509 calcium ion binding Molecular Function GO:0015631 tubulin binding Molecular Function |
| KEGG gene cross-reference | dme:Dmel_CG7641 dre:445319 mmu:53602 rno:50871 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF10591.16SPARC_Ca_bdg116-237 aaPF23564.2EF-hand_FSTL1164-237 aaPF13499.13EF-hand_7177-238 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_025736 | PF10591.16 | SPARC_Ca_bdg | 116 | 237 | 5.3e-06 | 27.4 |
| LXL04_025736 | PF23564.2 | EF-hand_FSTL1 | 164 | 237 | 6e-09 | 37.1 |
| LXL04_025736 | PF13499.13 | EF-hand_7 | 177 | 238 | 9.9e-17 | 61.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.