LXL04_024271 | RubberDandelionOmics

Gene overview

LXL04_024271

Reference: OH-1004 Chr: Chr05 Coordinates: 86256907-86258966 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

612 bp · LXL04_024271|LXL04_024271|OH1004|cDNA

ATGAAGCCAATCCTTGAGGAACAACAATCAAGCTGGTTTACTCGATCTCTTAGATCAGAATTTAAAGTTAAAATGTTGCAGGTTTCGGTGTGCAGTCCAGGTGTTATCTTGAATGGACGGTTTCTGTTGAAGATTATAGTGACAGATCATAAAGATTCTCGTTTATTAAGAGCATGTGCTAGAGAAGCTAACTACCACCACCTTCAAATCCTTATAAATGATTTCTCTATACCGAGTCAGACAGTCCAAATTAAAGTGTA...

CDS

Download CDS FASTA

612 bp · LXL04_024271|LXL04_024271|OH1004|CDS

ATGAAGCCAATCCTTGAGGAACAACAATCAAGCTGGTTTACTCGATCTCTTAGATCAGAATTTAAAGTTAAAATGTTGCAGGTTTCGGTGTGCAGTCCAGGTGTTATCTTGAATGGACGGTTTCTGTTGAAGATTATAGTGACAGATCATAAAGATTCTCGTTTATTAAGAGCATGTGCTAGAGAAGCTAACTACCACCACCTTCAAATCCTTATAAATGATTTCTCTATACCGAGTCAGACAGTCCAAATTAAAGTGTA...

Protein

Download Protein FASTA

203 aa · LXL04_024271|LXL04_024271|OH1004|PROTEIN

MKPILEEQQSSWFTRSLRSEFKVKMLQVSVCSPGVILNGRFLLKIIVTDHKDSRLLRACAREANYHHLQILINDFSIPSQTVQIKVYEREAFQMQEQAREIRGKKRSYQDRVKDLEDELQNAKMAEYRISIYGRKQSECDNLASWTVNCTNPLYRNNTKEIIDNGLDVLVNANIGDGKQVYKDVDLDGIREDWAHYVSNFVLA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024271`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024271

Location Chr05:86256907-86258966 (-)

Description Similar to SMC6B: Structural maintenance of chromosomes protein 6B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61460`	Core component of the SMC5-SMC6 complex that promotes sister chromatid alignment after DNA damage and facilitates double-stranded DNA breaks (DSBs) repair via homologous recombination between sister chromatids.	No verified direct reference in this release
`At2g38280`	AMP deaminase plays a critical role in energy metabolism.	EMBRYONIC FACTOR 1 encodes an AMP deaminase and is essential for the zygote to embryo transition in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02411.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0693500`	AMP deaminase plays a critical role in energy metabolism.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024271 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006188 IMP biosynthetic process Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0007062 sister chromatid cohesion Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010165 response to X-ray Biological Process

GO:0032264 IMP salvage Biological Process

GO:0046033 AMP metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G38280

ath:AT5G61460

dosa:Os07g0693500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.296

Rank 1 · LXL04_024271 · OH-1004

Mitochondrion0.253

Rank 2 · LXL04_024271 · OH-1004

Cytoplasm0.253

Rank 3 · LXL04_024271 · OH-1004

Plastid0.154

Rank 4 · LXL04_024271 · OH-1004

Cell membrane0.051

Rank 5 · LXL04_024271 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19326.6AMP_deaminase108-162 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024271	`PF19326.6`	AMP_deaminase	108	162	3.6e-08	33.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FII7`	Arabidopsis thaliana	Structural maintenance of chromosomes protein 6B	62.500%	Swiss-Prot	weak database homology
`O80452`	Arabidopsis thaliana	AMP deaminase	60.000%	Swiss-Prot	weak database homology
`Q84NP7`	Oryza sativa subsp. japonica	Probable AMP deaminase	46.053%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card