LXL04_023101 | RubberDandelionOmics

Gene overview

LXL04_023101

Reference: OH-1004 Chr: Chr05 Coordinates: 23276924-23279300 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1323 bp · LXL04_023101|LXL04_023101|OH1004|cDNA

ATGGCTGCATCTTCTAGCCTCCCCCTCCATATTTATCCTCTTCTGGAAGCAGTGGAGGAGTACGACGTGGTTGCCGAATTTGGTCAGGAACTTGAAGAAGACGATGAGGACGAGGTCGAGAGTGACGAGATTAATGATTTGGAGGTTGATGTTAACAAGTCTAAGTTTGAGGAGTTCAAGTGGCAAAGAATTGAGAGGATTCGTAATGACGTGAGGGAGTATGGTGATGGCATCCTTGATGTTGATGAACTTGCTTCCGT...

CDS

Download CDS FASTA

1323 bp · LXL04_023101|LXL04_023101|OH1004|CDS

ATGGCTGCATCTTCTAGCCTCCCCCTCCATATTTATCCTCTTCTGGAAGCAGTGGAGGAGTACGACGTGGTTGCCGAATTTGGTCAGGAACTTGAAGAAGACGATGAGGACGAGGTCGAGAGTGACGAGATTAATGATTTGGAGGTTGATGTTAACAAGTCTAAGTTTGAGGAGTTCAAGTGGCAAAGAATTGAGAGGATTCGTAATGACGTGAGGGAGTATGGTGATGGCATCCTTGATGTTGATGAACTTGCTTCCGT...

Protein

Download Protein FASTA

440 aa · LXL04_023101|LXL04_023101|OH1004|PROTEIN

MAASSSLPLHIYPLLEAVEEYDVVAEFGQELEEDDEDEVESDEINDLEVDVNKSKFEEFKWQRIERIRNDVREYGDGILDVDELASVYNFRIDKFQCLAIQALLRGSSVVVSAPTSAGKTLIAEAAAVAAVARGRRLFYTTPLKALSNQKFREFCDAFGEDNVGLLTGDPVIKKDAQVLIITIEILVGIMSSKSGLFHVDVIVLDEVHYLSDISQGTVWEEIVIYCPKEINQIHGKTEMVTSTKRPVPLTWHFSTRTALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023101`
TK1151 ID	TkA08G287210
OH-1004 ID	LXL04_023101
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	80.000
Protein coverage (%)	TK1151 75.484 / OH-1004 31.818 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023101

Location Chr05:23276924-23279300 (+)

Description Similar to ISE2: DExH-box ATP-dependent RNA helicase DExH15 chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70070`	RNA helicase involved in group II intron splicing.	Identification of a developmental transition in plasmodesmatal function during embryogenesis in Arabidopsis thaliana.2002 · DOI: 10.1242/dev.129.5.1261 INCREASED SIZE EXCLUSION LIMIT 2 encodes a putative DEVH box RNA helicase involved in plasmodesmata function during Arabidopsis embryogenesis.2007 · DOI: 10.1105/tpc.106.045666 Loss of INCREASED SIZE EXCLUSION LIMIT (ISE)1 or ISE2 increases the formation of secondary plasmodesmata.2010 · DOI: 10.1016/j.cub.2010.03.064 The chloroplastic DEVH-box RNA helicase INCREASED SIZE EXCLUSION LIMIT 2 involved in plasmodesmata regulation is required for group II intron splicing.2016 · DOI: 10.1111/pce.12603

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023101 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0000712 resolution of meiotic recombination intermediates Biological Process

GO:0006397 mRNA processing Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010497 plasmodesmata-mediated intercellular transport Biological Process

GO:0016441 post-transcriptional gene silencing Biological Process

GO:0016554 cytidine to uridine editing Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0070478 nuclear-transcribed mRNA catabolic process, 3'-5' exonucleolytic nonsense-mediated decay Biological Process

GO:1901259 chloroplast rRNA processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G70070

mle:ML1333

msm:MSMEG_3885

mtc:MT2153

mtu:Rv2092c

mtv:RVBD_2092c

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.369

Rank 1 · LXL04_023101 · OH-1004

Nucleus0.347

Rank 2 · LXL04_023101 · OH-1004

Plastid0.140

Rank 3 · LXL04_023101 · OH-1004

Mitochondrion0.099

Rank 4 · LXL04_023101 · OH-1004

Peroxisome0.079

Rank 5 · LXL04_023101 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD94-228 aa

PF04851.22ResIII105-228 aa

PF22527.3DEXQc_Suv3112-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023101	`PF00270.36`	DEAD	94	228	1.5e-21	77.6
LXL04_023101	`PF04851.22`	ResIII	105	228	3.4e-08	34.3
LXL04_023101	`PF22527.3`	DEXQc_Suv3	112	229	1.8e-07	31.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B9DFG3`	Arabidopsis thaliana	DExH-box ATP-dependent RNA helicase DExH15 chloroplastic	59.267%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card