LXL04_020918 | RubberDandelionOmics

Gene overview

LXL04_020918

Reference: OH-1004 Chr: Chr04 Coordinates: 114954739-114956699 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1464 bp · LXL04_020918|LXL04_020918|OH1004|cDNA

ATGGCAAATCTTGAAGATTCTTTTCTAGCAGATCTTGAAGATCTATCAGACAACGATAACGACAACTTGGATGAAGAAAATGCGGATGCAGAGCACATGGAAGAGGACATCAAAGGAGACATACCCGATTTAGAAACCCTAAACTACGAAGACCTAGACACCGTCTCGAAACTCCAAAAAACCCAACGATACACCGACATAATGCAAAAAGTCGAAAACGCCCTCGAGAAAAACTCCTCCTCCATTTCCACCCAATCCTC...

CDS

Download CDS FASTA

1464 bp · LXL04_020918|LXL04_020918|OH1004|CDS

ATGGCAAATCTTGAAGATTCTTTTCTAGCAGATCTTGAAGATCTATCAGACAACGATAACGACAACTTGGATGAAGAAAATGCGGATGCAGAGCACATGGAAGAGGACATCAAAGGAGACATACCCGATTTAGAAACCCTAAACTACGAAGACCTAGACACCGTCTCGAAACTCCAAAAAACCCAACGATACACCGACATAATGCAAAAAGTCGAAAACGCCCTCGAGAAAAACTCCTCCTCCATTTCCACCCAATCCTC...

Protein

Download Protein FASTA

487 aa · LXL04_020918|LXL04_020918|OH1004|PROTEIN

MANLEDSFLADLEDLSDNDNDNLDEENADAEHMEEDIKGDIPDLETLNYEDLDTVSKLQKTQRYTDIMQKVENALEKNSSSISTQSSLVLEDDPEYQLIVECNTLSVDIETEIAIIHNFIRDKYRLKFPELESLVHHPIDYARVVKKIGNEVDLTLVDLEGLLPSAIIMVVSVTASTTSGKPLPETTLQKTIEACDRALVLDSSKKKVLEFVESRMGYIAPNLSAIVGTAVAAKLMGTAGGLTCLAKMPACNVQLLGAKR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020918`
TK1151 ID	TkA05G333090
OH-1004 ID	LXL04_020918
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020918

Location Chr04:114954739-114956699 (-)

Description Similar to PRP31: U4/U6 small nuclear ribonucleoprotein Prp31 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g60170`	Involved in pre-mRNA splicing.	The Splicing Factor PRP31 Is Involved in Transcriptional Gene Silencing and Stress Response in Arabidopsis.2015 · DOI: 10.1016/j.molp.2015.02.003

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020918 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000244 spliceosomal tri-snRNP complex assembly Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006346 DNA methylation-dependent constitutive heterochromatin formation Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009409 response to cold Biological Process

GO:0009845 seed germination Biological Process

GO:0070417 cellular response to cold Biological Process

GO:0071166 ribonucleoprotein complex localization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

KEGG gene cross-reference

ath:AT1G60170

mmu:68988

xla:495301

xtr:407890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.921

Rank 1 · LXL04_020918 · OH-1004

Cytoplasm0.180

Rank 2 · LXL04_020918 · OH-1004

Mitochondrion0.025

Rank 3 · LXL04_020918 · OH-1004

Cell membrane0.015

Rank 4 · LXL04_020918 · OH-1004

Golgi apparatus0.008

Rank 5 · LXL04_020918 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01798.24Nop106-334 aa

PF09785.15Prp31_C341-459 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020918	`PF01798.24`	Nop	106	334	1.9e-71	240.9
LXL04_020918	`PF09785.15`	Prp31_C	341	459	7.8e-43	147.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXN6`	Arabidopsis thaliana	U4/U6 small nuclear ribonucleoprotein Prp31 homolog	75.410%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card