LXL04_020343 | RubberDandelionOmics

Gene overview

LXL04_020343

Reference: OH-1004 Chr: Chr04 Coordinates: 68473255-68476608 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1395 bp · LXL04_020343|LXL04_020343|OH1004|cDNA

ATGAGACGCCGACCAGGAATCGGTGGTTTACAGACTGCCGCCGCTGCTAGGACGCGTGGTGATCGTCCCGATCATGAAGCTGTTGATGCTGCTAAGGCGAGGCTTGCGGAGATTGACTCGATGTTTTCGAATGATCTCGATGAGATTAAATTGGAGGAGAAACAGAAGAAGGCGATCGAGAGGGAGAGGCAGATGCATAAAACTTTGATCTCGTTGGATCAGATGCATCAATCGTATGATAAAATGTTGTGCAAGGCGGA...

CDS

Download CDS FASTA

1395 bp · LXL04_020343|LXL04_020343|OH1004|CDS

ATGAGACGCCGACCAGGAATCGGTGGTTTACAGACTGCCGCCGCTGCTAGGACGCGTGGTGATCGTCCCGATCATGAAGCTGTTGATGCTGCTAAGGCGAGGCTTGCGGAGATTGACTCGATGTTTTCGAATGATCTCGATGAGATTAAATTGGAGGAGAAACAGAAGAAGGCGATCGAGAGGGAGAGGCAGATGCATAAAACTTTGATCTCGTTGGATCAGATGCATCAATCGTATGATAAAATGTTGTGCAAGGCGGA...

Protein

Download Protein FASTA

464 aa · LXL04_020343|LXL04_020343|OH1004|PROTEIN

MRRRPGIGGLQTAAAARTRGDRPDHEAVDAAKARLAEIDSMFSNDLDEIKLEEKQKKAIERERQMHKTLISLDQMHQSYDKMLCKAEKRLEKLYESVNAGKQPLQDINQAYVLPIKMMKKSLDKHHDDSANEISSSSKIDQKLCFKITSLTTAISVGSTAAQKRKQNAVSVGKERREALFRTKQLCRAGVSTDTDIPIDDNDMMIEEEQSILGKRCSPKKVIPLLAQCLSFGSQDEQLLEAAWCLTNIAAGKPEETRALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020343`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020343

Location Chr04:68473255-68476608 (+)

Description Similar to IMPA9: Importin subunit alpha-9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03070`	Binds to conventional NLS motifs and mediates nuclear protein import across the nuclear envelope (By similarity).	No verified direct reference in this release
`At5g67380`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	Cloning and characterization of two cDNAs encoding casein kinase II catalytic subunits in Arabidopsis thaliana.1993 · DOI: 10.1007/bf00019944 Reconstitution of Arabidopsis casein kinase II from recombinant subunits and phosphorylation of transcription factor GBF1.1995 · DOI: 10.1105/tpc.7.1.105
`At3g50000`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0158000`	Binds specifically and directly to substrates containing either a simple or bipartite NLS motif.	No verified direct reference in this release
`UniProt: B6F107`	Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020343 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006607 NLS-bearing protein import into nucleus Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009648 photoperiodism Biological Process

GO:0009908 flower development Biological Process

GO:0010225 response to UV-C Biological Process

GO:0010229 inflorescence development Biological Process

GO:0010332 response to gamma radiation Biological Process

GO:0042752 regulation of circadian rhythm Biological Process

KEGG gene cross-reference

ath:AT3G50000

ath:AT5G03070

ath:AT5G67380

dosa:Os01g0158000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.464

Rank 1 · LXL04_020343 · OH-1004

Cytoplasm0.407

Rank 2 · LXL04_020343 · OH-1004

Mitochondrion0.084

Rank 3 · LXL04_020343 · OH-1004

Cell membrane0.080

Rank 4 · LXL04_020343 · OH-1004

Endoplasmic reticulum0.061

Rank 5 · LXL04_020343 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30746.1TMCO6234-344 aa

PF13513.13HEAT_EZ239-289 aa

PF00514.30Arm294-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020343	`PF30746.1`	TMCO6	234	344	2.8e-06	27.0
LXL04_020343	`PF13513.13`	HEAT_EZ	239	289	2e-07	32.1
LXL04_020343	`PF00514.30`	Arm	294	331	1.7e-13	50.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KF65`	Arabidopsis thaliana	Importin subunit alpha-9	54.545%	Swiss-Prot	weak database homology
`Q08467`	Arabidopsis thaliana	Casein kinase II subunit alpha-1	75.676%	Swiss-Prot	weak database homology
`Q08466`	Arabidopsis thaliana	Casein kinase II subunit alpha-2	72.973%	Swiss-Prot	weak database homology
`Q9FYP9`	Oryza sativa subsp. japonica	Importin subunit alpha-2	50.847%	Swiss-Prot	moderate database homology
`B6F107`	Oryza sativa subsp. japonica	Casein kinase II subunit alpha-2	40.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card