LXL04_019658 | RubberDandelionOmics

Gene overview

LXL04_019658

Reference: OH-1004 Chr: Chr04 Coordinates: 36082479-36086294 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2424 bp · LXL04_019658|LXL04_019658|OH1004|cDNA

ATGGCTGTGCTCCTCTGTACTtttttcctcttctttttcGCCGCTGGCGAAGCCGTATCCACAGATCCGGCGGTCAAAACTTACATTTTCCGAGTAGATGGTGAATCGAAGCCGTCGATCTTTCCCACTCACTTCCACTGGTACACTTCCGAGTTCACTGAATCGAGCAGCATCCTTCATGTATACGACACAGTTTTCAGAGGCTTCTCTGCGTCTGTCACTTCCTCGCAAGCTTCCGCCTTggaaaagcatccatctgt...

CDS

Download CDS FASTA

2424 bp · LXL04_019658|LXL04_019658|OH1004|CDS

ATGGCTGTGCTCCTCTGTACTTTTTTCCTCTTCTTTTTCGCCGCTGGCGAAGCCGTATCCACAGATCCGGCGGTCAAAACTTACATTTTCCGAGTAGATGGTGAATCGAAGCCGTCGATCTTTCCCACTCACTTCCACTGGTACACTTCCGAGTTCACTGAATCGAGCAGCATCCTTCATGTATACGACACAGTTTTCAGAGGCTTCTCTGCGTCTGTCACTTCCTCGCAAGCTTCCGCCTTGGAAAAGCATCCATCTGT...

Protein

Download Protein FASTA

807 aa · LXL04_019658|LXL04_019658|OH1004|PROTEIN

MAVLLCTFFLFFFAAGEAVSTDPAVKTYIFRVDGESKPSIFPTHFHWYTSEFTESSSILHVYDTVFRGFSASVTSSQASALEKHPSVLAVFEDRRRELHTTRSPQFVGLRNQRGLWSESDYGSDVIIGVFDTGIWPERRSFTDLNLGPVPKRWKGVCQTGVKFTARNCNRKIVGARFFAKGHEAAGGFGGGIGFGGAINDTVEFRSPRDADGHGTHTASTAAGRYVFKASMAGYAAGIAKGVAPKARLAIYKVCWKSAGC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019658`
TK1151 ID	TkA05G071860
OH-1004 ID	LXL04_019658
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	92.800
Protein coverage (%)	TK1151 100.000 / OH-1004 66.914 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019658

Location Chr04:36082479-36086294 (+)

Description Similar to SBT1.6: Subtilisin-like protease SBT1.6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34980`	Subtilisin-like protease SBT1.6.	No verified direct reference in this release
`At3g14240`	Subtilisin-like protease SBT1.5.	No verified direct reference in this release
`At5g67360`	Serine protease.	Ara12 subtilisin-like protease from Arabidopsis thaliana: purification, substrate specificity and tissue localization.2003 · DOI: 10.1042/bj20021125 A subtilisin-like serine protease essential for mucilage release from Arabidopsis seed coats.2008 · DOI: 10.1111/j.1365-313x.2008.03437.x
`At2g05920`	Subtilisin-like protease SBT1.8.	No verified direct reference in this release
`At5g51750`	Subtilisin-like protease SBT1.3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019658 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0010214 seed coat development Biological Process

GO:0048731 system development Biological Process

GO:0080001 mucilage extrusion from seed coat Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0048046 apoplast Cellular Component

KEGG gene cross-reference

ath:AT2G05920

ath:AT3G14240

ath:AT4G34980

ath:AT5G51750

ath:AT5G67360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.623

Rank 1 · LXL04_019658 · OH-1004

Lysosome / Vacuole0.117

Rank 2 · LXL04_019658 · OH-1004

Cell membrane0.090

Rank 3 · LXL04_019658 · OH-1004

Endoplasmic reticulum0.054

Rank 4 · LXL04_019658 · OH-1004

Cytoplasm0.054

Rank 5 · LXL04_019658 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05922.22Inhibitor_I927-99 aa

PF00082.28Peptidase_S8122-595 aa

PF02225.28PA375-461 aa

PF17766.8fn3_6660-764 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019658	`PF05922.22`	Inhibitor_I9	27	99	1.1e-13	52.4
LXL04_019658	`PF00082.28`	Peptidase_S8	122	595	2.8e-45	155.6
LXL04_019658	`PF02225.28`	PA	375	461	9e-13	48.9
LXL04_019658	`PF17766.8`	fn3_6	660	764	1.5e-27	96.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49607`	Arabidopsis thaliana	Subtilisin-like protease SBT1.6	72.208%	Swiss-Prot	strong database homology
`Q9LUM3`	Arabidopsis thaliana	Subtilisin-like protease SBT1.5	57.218%	Swiss-Prot	strong database homology
`O65351`	Arabidopsis thaliana	Subtilisin-like protease SBT1.7	50.000%	Swiss-Prot	strong database homology
`Q9ZUF6`	Arabidopsis thaliana	Subtilisin-like protease SBT1.8	50.337%	Swiss-Prot	strong database homology
`Q9FLI4`	Arabidopsis thaliana	Subtilisin-like protease SBT1.3	49.615%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card