LXL04_019605 | RubberDandelionOmics

Gene overview

LXL04_019605

Reference: OH-1004 Chr: Chr04 Coordinates: 34986335-34991605 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3112 bp · LXL04_019605|LXL04_019605|OH1004|cDNA

TGCCATTTAGTCTAATTATCCCACCCATATATTTTTTTTAGCTCCAGCGGATCGTGTGGATTGCCTTGCTTTATCTATTTCTCATTCCCACACTCTCCCTCCCAGTGTCCGAGACAACAGCCATGGAAGCCTCCAAGCTTCCATGCTCATTTGCCTCGTTTCCGCCCTCCACAATAACCTCAAGAAATCGTACCAAATGCCACCATTCTCTTTCCCCTGGTTTTGGGAATTACAAAGACTTTATCGTACAAAGATTAGCA...

CDS

Download CDS FASTA

2970 bp · LXL04_019605|LXL04_019605|OH1004|CDS

ATGCTCATTTGCCTCGTTTCCGCCCTCCACAATAACCTCAAGAAATCGTACCAAATGCCACCATTCTCTTTCCCCTGGTTTTGGGAATTACAAAGACTTTATCGTACAAAGATTAGCACTAATCTATCCTTCTCGCTTGCCCTCCAGAAACCCAAGAGCCAAGAACAAGCAGCTCATCAGAAACACATCAGTCATATGATCTTCCGTATAGCTTCGGTACAACCACTCACAGAGGATCATATCCAAGAAAAATCTCAAGA...

Protein

Download Protein FASTA

989 aa · LXL04_019605|LXL04_019605|OH1004|PROTEIN

MLICLVSALHNNLKKSYQMPPFSFPWFWELQRLYRTKISTNLSFSLALQKPKSQEQAAHQKHISHMIFRIASVQPLTEDHIQEKSQDLSTSGNSIRRRFLEFYAARGHKILPSSSLVPDDPTVLLTIAGMLQFKPVFLGKVPRQVPSATTSQKCIRTNDIENVGRTSRHHTFFEMLGNFSFGDYFKKEAIKWAWELSTVEYGLPAENLWISVYEDDEETYAIWHDEIGVPANRIKKMGEEDNFWTSGLTGPCGPCSEIYY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019605`
TK1151 ID	TkA05G067910
OH-1004 ID	LXL04_019605
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 92.922 / OH-1004 92.922 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019605

Location Chr04:34986335-34991605 (-)

Description Similar to POPTRDRAFT_821063: Alanine--tRNA ligase, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22800`	Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8B4H5`	Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala).	No verified direct reference in this release
`Os06g0245800`	Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019605 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006419 alanyl-tRNA aminoacylation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0000049 tRNA binding Molecular Function

GO:0002161 aminoacyl-tRNA deacylase activity Molecular Function

GO:0004813 alanine-tRNA ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G22800

dosa:Os06g0245800

osa:9266147

pop:7472090

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.644

Rank 1 · LXL04_019605 · OH-1004

Mitochondrion0.266

Rank 2 · LXL04_019605 · OH-1004

Cytoplasm0.227

Rank 3 · LXL04_019605 · OH-1004

Peroxisome0.074

Rank 4 · LXL04_019605 · OH-1004

Nucleus0.061

Rank 5 · LXL04_019605 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01411.25tRNA-synt_2c95-658 aa

PF07973.20tRNA_SAD756-799 aa

PF02272.25DHHA1877-978 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019605	`PF01411.25`	tRNA-synt_2c	95	658	1.6e-196	654.9
LXL04_019605	`PF07973.20`	tRNA_SAD	756	799	2e-17	63.6
LXL04_019605	`PF02272.25`	DHHA1	877	978	4e-14	53.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFC7`	Arabidopsis thaliana	Alanine--tRNA ligase, chloroplastic/mitochondrial	73.458%	Swiss-Prot	strong database homology
`B8B4H5`	Oryza sativa subsp. indica	Alanine--tRNA ligase, chloroplastic/mitochondrial	73.000%	Swiss-Prot	strong database homology
`B9FSH5`	Oryza sativa subsp. japonica	Alanine--tRNA ligase, chloroplastic/mitochondrial	72.889%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card