RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_019557
Reference: OH-1004 Chr: Chr04 Coordinates: 33768322-33771155 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1038 bp · LXL04_019557|LXL04_019557|OH1004|cDNA

ATGGAGTACCGAAGAATCAAAGATCAGGATAAGGATGTGGATCCGGTTAATGAAGATCTCGAGAGCTTACGCGGCAAAGCTCTTTTAGATGTTCCTGCACCTTATGATAAAACAAAATGGAAGATGAAGTCGGTGGTGACACTAGCATTAACATTTCTAACAAGCTCCCAAGCCATCCTTATCGTCTGGTCCAAAAGAGCTGGAAGATACGAGTACAGTGTCACAACAGCAAACTTTTTGGTTGAGACTTTGAAATGTGC...

CDS

Download CDS FASTA

1038 bp · LXL04_019557|LXL04_019557|OH1004|CDS

ATGGAGTACCGAAGAATCAAAGATCAGGATAAGGATGTGGATCCGGTTAATGAAGATCTCGAGAGCTTACGCGGCAAAGCTCTTTTAGATGTTCCTGCACCTTATGATAAAACAAAATGGAAGATGAAGTCGGTGGTGACACTAGCATTAACATTTCTAACAAGCTCCCAAGCCATCCTTATCGTCTGGTCCAAAAGAGCTGGAAGATACGAGTACAGTGTCACAACAGCAAACTTTTTGGTTGAGACTTTGAAATGTGC...

Protein

Download Protein FASTA

345 aa · LXL04_019557|LXL04_019557|OH1004|PROTEIN

MEYRRIKDQDKDVDPVNEDLESLRGKALLDVPAPYDKTKWKMKSVVTLALTFLTSSQAILIVWSKRAGRYEYSVTTANFLVETLKCALSLAALARTWRTEGVTEDNRLSTTVDEVSVYPIPAALYLVKNLLQYYIFAYVDAPGYQILKNLNIISTGVLYRIILKKKLSEIQWAAFILLCAGCTTAQLNPSSDHVLQTPFLGWMMAIVMALLSGFAGVYTEAIIKKRPSRNINVQNFWLYVFGMAFNVVAIIVQDFDAVVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_019557
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_019557
LocationChr04:33768322-33771155 (-)
DescriptionSimilar to CSTLP2: CMP-sialic acid transporter 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g35335 Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi (By similarity). No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0573700 Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi (By similarity).
Analysis of CMP-sialic acid transporter-like proteins in plants.2009 · DOI: 10.1016/j.phytochem.2009.09.017
UniProt: B8B7Q4 Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi. No verified direct reference in this release
Os06g0523400 Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi.
Analysis of CMP-sialic acid transporter-like proteins in plants.2009 · DOI: 10.1016/j.phytochem.2009.09.017
UniProt: B8B350 Sugar transporter involved in the transport of CMP-sialic acid from the cytoplasm into the Golgi. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_019557 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0015739 sialic acid transport Biological Process
GO:0055085 transmembrane transport Biological Process
GO:0000139 Golgi membrane Cellular Component
GO:0005768 endosome Cellular Component
GO:0005794 Golgi apparatus Cellular Component
GO:0005802 trans-Golgi network Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0015136 sialic acid transmembrane transporter activity Molecular Function
GO:0015165 pyrimidine nucleotide-sugar transmembrane transporter activity Molecular Function
GO:0022857 transmembrane transporter activity Molecular Function
KEGG gene cross-reference
dosa:Os06g0523400
dosa:Os07g0573700
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.464
Rank 1 · LXL04_019557 · OH-1004
Endoplasmic reticulum0.199
Rank 2 · LXL04_019557 · OH-1004
Cytoplasm0.154
Rank 3 · LXL04_019557 · OH-1004
Lysosome / Vacuole0.146
Rank 4 · LXL04_019557 · OH-1004
Cell membrane0.093
Rank 5 · LXL04_019557 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04142.22Nuc_sug_transp40-338 aa
PF00892.27EamA56-182 aa
PF08449.18UAA99-339 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_019557PF04142.22Nuc_sug_transp403381.4e-57196.0
LXL04_019557PF00892.27EamA561824.2e-0627.8
LXL04_019557PF08449.18UAA993391.4e-1041.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4JN00Arabidopsis thalianaCMP-sialic acid transporter 480.563%Swiss-Protstrong database homology
Q6ZL17Oryza sativa subsp. japonicaCMP-sialic acid transporter 281.020%Swiss-Protstrong database homology
B8B7Q4Oryza sativa subsp. indicaCMP-sialic acid transporter 280.737%Swiss-Protstrong database homology
Q654D9Oryza sativa subsp. japonicaCMP-sialic acid transporter 140.604%Swiss-Protmoderate database homology
B8B350Oryza sativa subsp. indicaCMP-sialic acid transporter 139.934%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser