LXL04_019441 | RubberDandelionOmics

Gene overview

LXL04_019441

Reference: OH-1004 Chr: Chr04 Coordinates: 31389111-31398384 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3153 bp · LXL04_019441|LXL04_019441|OH1004|cDNA

ACGGCGATGGAACGAACTGTGTCAAGCAGTTCACGAGAAGATGAGCTGCAGAACGACGACGGAGGAAAGAGACACACTGAGGAGACGGAGATGGAGTCGATAGAAAAGATATTCGAGAGCAAGAAGGTTCCTCCATGGCAGAAACAGCTAACACTCAGGGCATTCGTCGTGAGTTTTATTTTGGGGATTATGTTCACGTTCATTGTTATGAAGCTTAATCTTACTACCGGAATCATTCCTTCTCTCAACGTCTCCGCCGG...

CDS

Download CDS FASTA

3147 bp · LXL04_019441|LXL04_019441|OH1004|CDS

ATGGAACGAACTGTGTCAAGCAGTTCACGAGAAGATGAGCTGCAGAACGACGACGGAGGAAAGAGACACACTGAGGAGACGGAGATGGAGTCGATAGAAAAGATATTCGAGAGCAAGAAGGTTCCTCCATGGCAGAAACAGCTAACACTCAGGGCATTCGTCGTGAGTTTTATTTTGGGGATTATGTTCACGTTCATTGTTATGAAGCTTAATCTTACTACCGGAATCATTCCTTCTCTCAACGTCTCCGCCGGACTGTT...

Protein

Download Protein FASTA

1048 aa · LXL04_019441|LXL04_019441|OH1004|PROTEIN

MERTVSSSSREDELQNDDGGKRHTEETEMESIEKIFESKKVPPWQKQLTLRAFVVSFILGIMFTFIVMKLNLTTGIIPSLNVSAGLLGFFFVKTWTKFLDKSGMLKQPFTRQENTVIQTCVVATSGIAFSVRCHDVRGFGSYLFGMSELIAKQSREANAEQNTKNPSLAWMIAFLFVVSFLGLFSVVPLRKIMIIDFKLIYPSGTATAHLINSFHTPQGAKLAKKQVRALGKFFSFSFLWGFFQWFFTGGDGCGFSSFPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019441`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019441

Location Chr04:31389111-31398384 (+)

Description Similar to YSL7: Probable metal-nicotianamine transporter YSL7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65730`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release
`At3g17650`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release
`At1g48370`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0524600`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release
`Os04g0674600`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019441 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0016020 membrane Cellular Component

GO:0035673 oligopeptide transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G65730

dosa:Os04g0524600

dosa:Os04g0674600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.390

Rank 1 · LXL04_019441 · OH-1004

Cell membrane0.251

Rank 2 · LXL04_019441 · OH-1004

Endoplasmic reticulum0.206

Rank 3 · LXL04_019441 · OH-1004

Cytoplasm0.102

Rank 4 · LXL04_019441 · OH-1004

Golgi apparatus0.088

Rank 5 · LXL04_019441 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03169.21OPT47-672 aa

PF03169.21OPT789-1044 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019441	`PF03169.21`	OPT	47	672	7.6e-225	749.0
LXL04_019441	`PF03169.21`	OPT	789	1044	7.6e-225	749.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHY2`	Arabidopsis thaliana	Probable metal-nicotianamine transporter YSL7	75.832%	Swiss-Prot	moderate database homology
`Q9LUN2`	Arabidopsis thaliana	Probable metal-nicotianamine transporter YSL5	70.198%	Swiss-Prot	moderate database homology
`Q6R3K4`	Arabidopsis thaliana	Probable metal-nicotianamine transporter YSL8	72.156%	Swiss-Prot	moderate database homology
`Q5JQD7`	Oryza sativa subsp. japonica	Probable metal-nicotianamine transporter YSL12	71.922%	Swiss-Prot	moderate database homology
`Q0J932`	Oryza sativa subsp. japonica	Probable metal-nicotianamine transporter YSL10	68.367%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card