Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1200 bp · LXL04_017515|LXL04_017515|OH1004|cDNA
ATGTCGAGCGAGGGCGAAGATGCGGTTCGTCGCCGTACGGCGGTAACCGAGTACCGGAAGAAGATGCTTCAGCATAAAGAGCTTGATTCTCGAGTTCGAGGAGtgagagagagtttgagaaGTACAAAGAAGGATTATGCAAAAACAGAAGATGATTTGAAATCCCTTCAAAGTGTTGGACAGATAATAGGCGAAGTCCTTAGACCTCTAGACAACGAACGATTGATTGTTAAAGCAAGTAGTGGTCCAAGGTATGTGGT...
1200 bp · LXL04_017515|LXL04_017515|OH1004|CDS
ATGTCGAGCGAGGGCGAAGATGCGGTTCGTCGCCGTACGGCGGTAACCGAGTACCGGAAGAAGATGCTTCAGCATAAAGAGCTTGATTCTCGAGTTCGAGGAGTGAGAGAGAGTTTGAGAAGTACAAAGAAGGATTATGCAAAAACAGAAGATGATTTGAAATCCCTTCAAAGTGTTGGACAGATAATAGGCGAAGTCCTTAGACCTCTAGACAACGAACGATTGATTGTTAAAGCAAGTAGTGGTCCAAGGTATGTGGT...
Protein
Download Protein FASTA399 aa · LXL04_017515|LXL04_017515|OH1004|PROTEIN
MSSEGEDAVRRRTAVTEYRKKMLQHKELDSRVRGVRESLRSTKKDYAKTEDDLKSLQSVGQIIGEVLRPLDNERLIVKASSGPRYVVGCRSKVDKEKLTAGTRVVLDMTTLTIMRALPREVDPVVYNMLHEDPGNISYSAVGGLSDQIRELRESIELPLMNPELFIRVGIKPPKGVLLYGPPGTGKTLLARAIASNIDANFLKVVSSAIIDKYIGESARLIREMFNYARDHQPCIIFMDEIDAIGGRRFSEGTSADREIQ...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_017515 |
|---|---|
| TK1151 ID | TkA02G037180 |
| OH-1004 ID | LXL04_017515 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_017515 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:152341925-152346283 (-) | |||||||||
| Description | Similar to RPT4B: 26S proteasome regulatory subunit S10B homolog B | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006979 response to oxidative stress Biological Process GO:0010498 proteasomal protein catabolic process Biological Process GO:0036503 ERAD pathway Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0045899 positive regulation of RNA polymerase II transcription preinitiation complex assembly Biological Process GO:0061136 regulation of proteasomal protein catabolic process Biological Process GO:0071357 cellular response to type I interferon Biological Process GO:0090261 positive regulation of inclusion body assembly Biological Process GO:1901800 positive regulation of proteasomal protein catabolic process Biological Process GO:0000502 proteasome complex Cellular Component GO:0005634 nucleus Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G45000 ath:AT5G43010 hsa:5706 iti:101969826 mmu:67089 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF16450.12Prot_ATP_ID_OB_C63-118 aaPF13191.13AAA_16172-200 aaPF07728.21AAA_5175-296 aaPF05496.19RuvB_N175-242 aaPF00004.36AAA176-309 aaPF17862.8AAA_lid_3332-374 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_017515 | PF16450.12 | Prot_ATP_ID_OB_C | 63 | 118 | 9.1e-16 | 58.2 |
| LXL04_017515 | PF13191.13 | AAA_16 | 172 | 200 | 1.2e-06 | 29.8 |
| LXL04_017515 | PF07728.21 | AAA_5 | 175 | 296 | 2.2e-06 | 28.4 |
| LXL04_017515 | PF05496.19 | RuvB_N | 175 | 242 | 3.1e-06 | 27.8 |
| LXL04_017515 | PF00004.36 | AAA | 176 | 309 | 2.2e-44 | 151.8 |
| LXL04_017515 | PF17862.8 | AAA_lid_3 | 332 | 374 | 7.9e-13 | 48.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.