LXL04_015618 | RubberDandelionOmics

Gene overview

LXL04_015618

Reference: OH-1004 Chr: Chr03 Coordinates: 77737119-77739474 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1065 bp · LXL04_015618|LXL04_015618|OH1004|cDNA

ATAGGATGTGATATAATCGTAAATAAAGAAAAAAGGGGTTTCACGGATCATGCAGAAATAATAATTGATGCCATGATTTCCATTGACAGTATGAAAAAGAAATCATCTGTTAAATCATCCAAATTAGGATTAAAGATTGCTTAACGTATGGAACTTTTATCACAAATCCCATTGGGTCAAAAGATGAAGTTCACGAATTTCCAAATAAGGAGACAACAATAGATGATGGGGAACTTGTTTCATATGGAACTGGGTAATGC...

CDS

Download CDS FASTA

843 bp · LXL04_015618|LXL04_015618|OH1004|CDS

ATGATGGGGAACTTGTTTCATATGGAACTGGGTAATGCTACTTACAGGTTTAGTTTTACATTGTGTTTTTACTTTGTGGGTTTGACCCTGTTCGATCAAAAGAACTTGAAGAGAAGATATCATCAAGTGGTTAGTGCTTTTGTGAGTAATACATGGAGCCCAAAGTGCACACATGTGGTTCTTGGTGATAATGCATCAGTAATGTCCAAAATAGATTTTGTCTGTTACAAATGGATAGAGTCACTTGCAGACAAACGAAT...

Protein

Download Protein FASTA

280 aa · LXL04_015618|LXL04_015618|OH1004|PROTEIN

MMGNLFHMELGNATYRFSFTLCFYFVGLTLFDQKNLKRRYHQVVSAFVSNTWSPKCTHVVLGDNASVMSKIDFVCYKWIESLADKRIDTKIPSCGSDDSNLMLEGVCVKIRDTESRDNCLSGHTFLLESTQKYKVKEKLQALLETFGVKALPIEDFIPRSQGFEEDENNHVVHVISVDNSECTRNLTSIPNVTKLNLICATLSGPATWILLFLYRHLMATQSGKSFYNLVPFSQNPYNGRGYKGRKKRNQREVVLDDLFN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015618`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015618

Location Chr03:77737119-77739474 (-)

Description Similar to NBS1: Nijmegen breakage syndrome 1 protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02680`	Component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	NBS1 is involved in DNA repair and plays a synergistic role with ATM in mediating meiotic homologous recombination in plants.2007 · DOI: 10.1111/j.1365-313x.2007.03220.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0487300`	Component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`UniProt: B8BHK8`	Component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015618 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006312 mitotic recombination Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0071479 cellular response to ionizing radiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005694 chromosome Cellular Component

GO:0030870 Mre11 complex Cellular Component

GO:0003684 damaged DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G02680

dosa:Os10g0487300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.798

Rank 1 · LXL04_015618 · OH-1004

Cytoplasm0.289

Rank 2 · LXL04_015618 · OH-1004

Mitochondrion0.041

Rank 3 · LXL04_015618 · OH-1004

Cell membrane0.027

Rank 4 · LXL04_015618 · OH-1004

Endoplasmic reticulum0.017

Rank 5 · LXL04_015618 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0H8D7`	Arabidopsis thaliana	Nibrin homolog	28.251%	Swiss-Prot	weak database homology
`Q7XD82`	Oryza sativa subsp. japonica	Nibrin homolog	29.439%	Swiss-Prot	weak database homology
`B8BHK8`	Oryza sativa subsp. indica	Nibrin homolog	28.972%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card