LXL04_014847 | RubberDandelionOmics

Gene overview

LXL04_014847

Reference: OH-1004 Chr: Chr03 Coordinates: 57954814-57960153 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2526 bp · LXL04_014847|LXL04_014847|OH1004|cDNA

ATGGTTTATACACTGCCTGGGATTCGGTTGAATACTCTTCCATCAATTCCCCAGTGCTGTGGTGATCGAAGGGGTACTGTTGCTGCTTCTAGCTCCACAAATCTGTCACTATTGTTGAGAAAAAGTTCATTAACCCGGAAGTTTATAGGTGGAAGATCTGAATCCCAATCTTTTATAGTTGGTGCAACAGAGAAAGTACTTGTACCTGACAGTCAAAGTGATGGCTCTTCTTCAGTTGACCAACTAGATACTCAACATTC...

CDS

Download CDS FASTA

2526 bp · LXL04_014847|LXL04_014847|OH1004|CDS

ATGGTTTATACACTGCCTGGGATTCGGTTGAATACTCTTCCATCAATTCCCCAGTGCTGTGGTGATCGAAGGGGTACTGTTGCTGCTTCTAGCTCCACAAATCTGTCACTATTGTTGAGAAAAAGTTCATTAACCCGGAAGTTTATAGGTGGAAGATCTGAATCCCAATCTTTTATAGTTGGTGCAACAGAGAAAGTACTTGTACCTGACAGTCAAAGTGATGGCTCTTCTTCAGTTGACCAACTAGATACTCAACATTC...

Protein

Download Protein FASTA

841 aa · LXL04_014847|LXL04_014847|OH1004|PROTEIN

MVYTLPGIRLNTLPSIPQCCGDRRGTVAASSSTNLSLLLRKSSLTRKFIGGRSESQSFIVGATEKVLVPDSQSDGSSSVDQLDTQHSKISENEVNLDEEQFEEMNEKEFVGSPVLVEDIAAREEVPLFDIDKETAEIRQLSIPSPGTGQKIYEIDPLLSNHREHLEYRYSHYKKIREAIDKYEGGLEAFSRGYERLGFTRSKTGITYREWAPGAKSASLIGDFNNWNPNADVMTRNEFGVWEIFLPNNADDSPPIPHGSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014847`
TK1151 ID	TkA02G392250
OH-1004 ID	LXL04_014847
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014847

Location Chr03:57954814-57960153 (+)

Description Similar to SBEI: 1,4-alpha-glucan-branching enzyme 1, chloroplastic/amyloplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03650`	Catalyzes the formation of the alpha-1,6-glucosidic linkages in starch by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position.	No verified direct reference in this release
`At2g36390`	Catalyzes the formation of the alpha-1,6-glucosidic linkages in starch by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0726400`	Catalyzes the formation of the alpha-1,6-glucosidic linkages in starch by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014847 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0005978 glycogen biosynthetic process Biological Process

GO:0005982 starch metabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010021 amylopectin biosynthetic process Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0071329 cellular response to sucrose stimulus Biological Process

GO:0071332 cellular response to fructose stimulus Biological Process

GO:0071333 cellular response to glucose stimulus Biological Process

GO:0071482 cellular response to light stimulus Biological Process

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G36390

ath:AT5G03650

zma:542238

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.942

Rank 1 · LXL04_014847 · OH-1004

Cytoplasm0.057

Rank 2 · LXL04_014847 · OH-1004

Mitochondrion0.041

Rank 3 · LXL04_014847 · OH-1004

Cell membrane0.035

Rank 4 · LXL04_014847 · OH-1004

Peroxisome0.031

Rank 5 · LXL04_014847 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02922.25CBM_48196-278 aa

PF00128.32Alpha-amylase344-482 aa

PF02806.25Alpha-amylase_C733-827 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014847	`PF02922.25`	CBM_48	196	278	1.2e-19	71.2
LXL04_014847	`PF00128.32`	Alpha-amylase	344	482	3.4e-11	43.7
LXL04_014847	`PF02806.25`	Alpha-amylase_C	733	827	8.5e-22	78.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZS3`	Arabidopsis thaliana	1,4-alpha-glucan-branching enzyme 2-2, chloroplastic/amyloplastic	74.424%	Swiss-Prot	strong database homology
`O23647`	Arabidopsis thaliana	1,4-alpha-glucan-branching enzyme 2-1, chloroplastic/amyloplastic	72.328%	Swiss-Prot	strong database homology
`Q01401`	Oryza sativa subsp. japonica	1,4-alpha-glucan-branching enzyme, chloroplastic/amyloplastic	56.403%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card