Gene Card
Gene overview
cDNA / CDS / Protein Sequences
999 bp · LXL04_014152|LXL04_014152|OH1004|cDNA
ATGTCATCTACCAATCAAAATAAGTGTTTGCCTCCGTCCTCCATGCCACGACTTCGCACGAAAATGCTCACCATGTACACTTGGGCTAGTGTGTACCGTCGGATGGCCACCTACTCACCCACCAAGATGCCGCAACTTGTAGGGATGAGCATTAGATGCCTACTCCCTTACACGATCCTAGACTATATCGACGACAGTAGCACCAGTAATTTTAAGCGCAAGCAGATGAAAACCCACGGCGACGTGAATGCTCAATCGTT...
999 bp · LXL04_014152|LXL04_014152|OH1004|CDS
ATGTCATCTACCAATCAAAATAAGTGTTTGCCTCCGTCCTCCATGCCACGACTTCGCACGAAAATGCTCACCATGTACACTTGGGCTAGTGTGTACCGTCGGATGGCCACCTACTCACCCACCAAGATGCCGCAACTTGTAGGGATGAGCATTAGATGCCTACTCCCTTACACGATCCTAGACTATATCGACGACAGTAGCACCAGTAATTTTAAGCGCAAGCAGATGAAAACCCACGGCGACGTGAATGCTCAATCGTT...
Protein
Download Protein FASTA332 aa · LXL04_014152|LXL04_014152|OH1004|PROTEIN
MSSTNQNKCLPPSSMPRLRTKMLTMYTWASVYRRMATYSPTKMPQLVGMSIRCLLPYTILDYIDDSSTSNFKRKQMKTHGDVNAQSLFNSFRHGFRSLSHNAHWVTSPGFQISIASSILSVAGLIIAFRDGRGRRGFNNLLLSWSSSSENESSPEKLWAVPGLQNLGNNCFLNVVLQALASCSSFLSSLQNIVEEVEASSEIEQIGDMPLAVSLNSLLQELCIIRHEGKVLSPRKVMLAMALYTPNFNLTSQQDAEEALA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_014152 |
|---|---|
| TK1151 ID | TkA02G450140 |
| OH-1004 ID | LXL04_014152 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 99.600 |
| Protein coverage (%) | TK1151 54.681 / OH-1004 77.410Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_014152 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr03:42884417-42886226 (-) | |||||||||
| Description | Similar to UBP27: Ubiquitin carboxyl-terminal hydrolase 27 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000422 autophagy of mitochondrion Biological Process GO:0006508 proteolysis Biological Process GO:0007032 endosome organization Biological Process GO:0007265 Ras protein signal transduction Biological Process GO:0008053 mitochondrial fusion Biological Process GO:0016579 protein deubiquitination Biological Process GO:0031647 regulation of protein stability Biological Process GO:0035871 protein K11-linked deubiquitination Biological Process GO:0044313 protein K6-linked deubiquitination Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G32850 ath:AT4G39370 dme:Dmel_CG4165 dre:559099 xtr:733894 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00443.36UCH162-328 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_014152 | PF00443.36 | UCH | 162 | 328 | 6.8e-19 | 69.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.