LXL04_012675 | RubberDandelionOmics

Gene overview

LXL04_012675

Reference: OH-1004 Chr: Chr03 Coordinates: 16723729-16724225 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

333 bp · LXL04_012675|LXL04_012675|OH1004|cDNA

ATGGAAGATTACAGACGACAAGGTGGAATTCAGCAATTGCTAGTTGCTGAACAAGAAGCTCGACAAATTGTCAACACTGCTAGAACCGCAAAACTTAATCGACTTAAGCAAGCAAAAAATGAAGCCGATGAAGAAGTAGCTAAATATCGTGCTCATATGGAGAAAGAATTCCAGAAAACAATATCAGAGTCGAGTGGTTTTTCTGGATCGAATGTAAAAAGGCTGGATGAAGAAACAGTTACAAAGATCGATCAGTTAAA...

CDS

Download CDS FASTA

333 bp · LXL04_012675|LXL04_012675|OH1004|CDS

ATGGAAGATTACAGACGACAAGGTGGAATTCAGCAATTGCTAGTTGCTGAACAAGAAGCTCGACAAATTGTCAACACTGCTAGAACCGCAAAACTTAATCGACTTAAGCAAGCAAAAAATGAAGCCGATGAAGAAGTAGCTAAATATCGTGCTCATATGGAGAAAGAATTCCAGAAAACAATATCAGAGTCGAGTGGTTTTTCTGGATCGAATGTAAAAAGGCTGGATGAAGAAACAGTTACAAAGATCGATCAGTTAAA...

Protein

Download Protein FASTA

110 aa · LXL04_012675|LXL04_012675|OH1004|PROTEIN

MEDYRRQGGIQQLLVAEQEARQIVNTARTAKLNRLKQAKNEADEEVAKYRAHMEKEFQKTISESSGFSGSNVKRLDEETVTKIDQLKKQAAKVSPEVVKMLMNHVTSIKI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012675`
TK1151 ID	TkA04G199610
OH-1004 ID	LXL04_012675
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	56.900
Protein coverage (%)	TK1151 76.224 / OH-1004 99.091 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012675

Location Chr03:16723729-16724225 (-)

Description Similar to VATG: V-type proton ATPase subunit G

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01390`	Catalytic subunit of the peripheral V1 complex of vacuolar ATPase (V-ATPase).	No verified direct reference in this release
`At4g23710`	Catalytic subunit of the peripheral V1 complex of vacuolar ATPase (V-ATPase).	No verified direct reference in this release
`At4g25950`	Catalytic subunit of the peripheral V1 complex of vacuolar ATPase (V-ATPase).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012675 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000221 vacuolar proton-transporting V-type ATPase, V1 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0016469 proton-transporting two-sector ATPase complex Cellular Component

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0046933 proton-transporting ATP synthase activity, rotational mechanism Molecular Function

GO:0046961 proton-transporting ATPase activity, rotational mechanism Molecular Function

KEGG gene cross-reference

ath:AT3G01390

ath:AT4G23710

ath:AT4G25950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.536

Rank 1 · LXL04_012675 · OH-1004

Cell membrane0.328

Rank 2 · LXL04_012675 · OH-1004

Nucleus0.159

Rank 3 · LXL04_012675 · OH-1004

Golgi apparatus0.088

Rank 4 · LXL04_012675 · OH-1004

Lysosome / Vacuole0.085

Rank 5 · LXL04_012675 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03179.21V-ATPase_G6-109 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012675	`PF03179.21`	V-ATPase_G	6	109	1.3e-31	110.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82628`	Arabidopsis thaliana	V-type proton ATPase subunit G1	59.633%	Swiss-Prot	strong database homology
`O82629`	Arabidopsis thaliana	V-type proton ATPase subunit G2	56.436%	Swiss-Prot	strong database homology
`Q9SZH0`	Arabidopsis thaliana	V-type proton ATPase subunit G3	50.467%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card