LXL04_012285 | RubberDandelionOmics

Gene overview

LXL04_012285

Reference: OH-1004 Chr: Chr03 Coordinates: 9778362-9781706 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1662 bp · LXL04_012285|LXL04_012285|OH1004|cDNA

ATGGAAGCACAGGAAGAAGGAAATTTGGAAGAAGATTGGGAAGAAGATCGCACCTGTGAAGAAGAAAATCAATATTCCCTTACGAGTACCGTTGTACATGTTGACCAGTCACGCAGTTGCTTGACTACCCGCGTCTCCCGTTCCCTTCCCCAATTCCTTCCGGAAACAACTTCCGGCGAGACATACGGAGCTATTGATTTAAGCTCAATTCGTAGGAAATTTGACGAGGCTATATCAACTGGTCATCAGCATATTTCCCA...

CDS

Download CDS FASTA

1662 bp · LXL04_012285|LXL04_012285|OH1004|CDS

ATGGAAGCACAGGAAGAAGGAAATTTGGAAGAAGATTGGGAAGAAGATCGCACCTGTGAAGAAGAAAATCAATATTCCCTTACGAGTACCGTTGTACATGTTGACCAGTCACGCAGTTGCTTGACTACCCGCGTCTCCCGTTCCCTTCCCCAATTCCTTCCGGAAACAACTTCCGGCGAGACATACGGAGCTATTGATTTAAGCTCAATTCGTAGGAAATTTGACGAGGCTATATCAACTGGTCATCAGCATATTTCCCA...

Protein

Download Protein FASTA

553 aa · LXL04_012285|LXL04_012285|OH1004|PROTEIN

MEAQEEGNLEEDWEEDRTCEEENQYSLTSTVVHVDQSRSCLTTRVSRSLPQFLPETTSGETYGAIDLSSIRRKFDEAISTGHQHISHIKRSYKQYWHLPCEFLFLVVRRLGKRWNKQTGYGDGDGKCNWCLHSGVCEMNKRRGSELKTQVEEKKLKVTVKHETSEEEESEGEEEEEEEEEEEEEVEEEEEEEEEEEEEEEEEDDDDDDDESSKKETLKKLLEPLPKDKIIEFLKEAAINDPSILSTLTETAEVDPAHRKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012285`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012285

Location Chr03:9778362-9781706 (-)

Description Similar to UBA2B: UBP1-associated protein 2B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g41060`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of a complex regulating the turnover of mRNAs in the nucleus.	No verified direct reference in this release
`At3g56860`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of a complex regulating the turnover of mRNAs in the nucleus.	UBA1 and UBA2, two proteins that interact with UBP1, a multifunctional effector of pre-mRNA maturation in plants.2002 · DOI: 10.1128/mcb.22.12.4346-4357.2002
`At3g15010`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-like protein that acts as a component of a complex regulating the turnover of mRNAs in the nucleus.	No verified direct reference in this release
`At2g22090`	Acts as a component of a complex regulating the turnover of mRNAs in the nucleus.	UBA1 and UBA2, two proteins that interact with UBP1, a multifunctional effector of pre-mRNA maturation in plants.2002 · DOI: 10.1128/mcb.22.12.4346-4357.2002

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0265800`	RNA-binding protein that binds to a cis-localization element or zipcode, within the 5'-CDS of prolamine RNA.	Characterization of RNA binding protein RBP-P reveals a possible role in rice glutelin gene expression and RNA localization.2014 · DOI: 10.1007/s11103-014-0191-z RNA-Binding Protein RBP-P Is Required for Glutelin and Prolamine mRNA Localization in Rice Endosperm Cells.2018 · DOI: 10.1105/tpc.18.00321 Zipcode RNA-Binding Proteins and Membrane Trafficking Proteins Cooperate to Transport Glutelin mRNAs in Rice Endosperm.2020 · DOI: 10.1105/tpc.20.00111

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012285 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009693 ethylene biosynthetic process Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010150 leaf senescence Biological Process

GO:0012501 programmed cell death Biological Process

GO:0048255 mRNA stabilization Biological Process

GO:0051028 mRNA transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0035925 mRNA 3'-UTR AU-rich region binding Molecular Function

KEGG gene cross-reference

ath:AT2G22090

ath:AT2G41060

ath:AT3G15010

ath:AT3G56860

dosa:Os01g0265800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.773

Rank 1 · LXL04_012285 · OH-1004

Cytoplasm0.261

Rank 2 · LXL04_012285 · OH-1004

Cell membrane0.042

Rank 3 · LXL04_012285 · OH-1004

Mitochondrion0.031

Rank 4 · LXL04_012285 · OH-1004

Endoplasmic reticulum0.028

Rank 5 · LXL04_012285 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16367.12RRM_7258-323 aa

PF00076.29RRM_1260-326 aa

PF00076.29RRM_1360-428 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012285	`PF16367.12`	RRM_7	258	323	1.4e-08	35.3
LXL04_012285	`PF00076.29`	RRM_1	260	326	2.9e-27	95.0
LXL04_012285	`PF00076.29`	RRM_1	360	428	2.9e-27	95.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80678`	Arabidopsis thaliana	UBP1-associated protein 2B	35.575%	Swiss-Prot	moderate database homology
`Q9LES2`	Arabidopsis thaliana	UBP1-associated protein 2A	36.408%	Swiss-Prot	moderate database homology
`Q9LKA4`	Arabidopsis thaliana	UBP1-associated protein 2C	42.411%	Swiss-Prot	weak database homology
`Q9SHZ6`	Arabidopsis thaliana	UBP1-associated proteins 1A	53.226%	Swiss-Prot	weak database homology
`Q9LJ04`	Oryza sativa subsp. japonica	RNA-binding protein P	46.218%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card