LXL04_012282 | RubberDandelionOmics

Gene overview

LXL04_012282

Reference: OH-1004 Chr: Chr03 Coordinates: 9724388-9731450 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1068 bp · LXL04_012282|LXL04_012282|OH1004|cDNA

ATgattttctttgttaagaatcCAAAGGGAGCGTTCTTCCTCTTAACCATCCTTCTTCTTGTATTTTCTTCCTATGCGTTGAGTCTCCCCAGAGGTAGACCAAAACCAACATGGACGTTGCCACCTCTCCGGACTGCACGTAAGCTGGCTGACGACAAGAACCCAAGGTGGAAGGAATTTTTTAAGTTTGTGTTGGAAATCATTGCAGCTGTATTTCTTCTTCGTACTGTTCTTCGCATCAAGGCTGCTGAAGGTGCGAG...

CDS

Download CDS FASTA

1068 bp · LXL04_012282|LXL04_012282|OH1004|CDS

ATGATTTTCTTTGTTAAGAATCCAAAGGGAGCGTTCTTCCTCTTAACCATCCTTCTTCTTGTATTTTCTTCCTATGCGTTGAGTCTCCCCAGAGGTAGACCAAAACCAACATGGACGTTGCCACCTCTCCGGACTGCACGTAAGCTGGCTGACGACAAGAACCCAAGGTGGAAGGAATTTTTTAAGTTTGTGTTGGAAATCATTGCAGCTGTATTTCTTCTTCGTACTGTTCTTCGCATCAAGGCTGCTGAAGGTGCGAG...

Protein

Download Protein FASTA

355 aa · LXL04_012282|LXL04_012282|OH1004|PROTEIN

MIFFVKNPKGAFFLLTILLLVFSSYALSLPRGRPKPTWTLPPLRTARKLADDKNPRWKEFFKFVLEIIAAVFLLRTVLRIKAAEGARIAGASRIIGVDLNANRFELARKFGVTEFVKPKDYEKPVQEVIAEMTNGGVDRSVECTGHIDAMISAFECVHDELELEKFITHEVPFSEINKAFDLMLRGEGLRALFHHQDTSIPRSIPHHLHRQMASLWRAVMGESPPNPDDYDGVQYWLNPERTGWLTKQGEYIKTWRRRWF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012282`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012282

Location Chr03:9724388-9731450 (-)

Description Similar to PH1: Pleckstrin homology domain-containing protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g29700`	Binds specifically to phosphatidylinositol 3-phosphate (PtdIns3P), but not to other phosphoinositides.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012282 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001881 receptor recycling Biological Process

GO:0007032 endosome organization Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0046294 formaldehyde catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005829 cytosol Cellular Component

GO:0055037 recycling endosome Cellular Component

GO:0004022 alcohol dehydrogenase (NAD+) activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G29700

sly:544074

sot:102577519

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.288

Rank 1 · LXL04_012282 · OH-1004

Endoplasmic reticulum0.247

Rank 2 · LXL04_012282 · OH-1004

Cell membrane0.167

Rank 3 · LXL04_012282 · OH-1004

Nucleus0.164

Rank 4 · LXL04_012282 · OH-1004

Mitochondrion0.154

Rank 5 · LXL04_012282 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00107.33ADH_zinc_N82-159 aa

PF00169.36PH240-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012282	`PF00107.33`	ADH_zinc_N	82	159	4e-15	56.6
LXL04_012282	`PF00169.36`	PH	240	336	2.3e-19	70.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ST43`	Arabidopsis thaliana	Pleckstrin homology domain-containing protein 1	68.493%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card