LXL04_011384 | RubberDandelionOmics

Gene overview

LXL04_011384

Reference: OH-1004 Chr: Chr02 Coordinates: 163595352-163602664 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1224 bp · LXL04_011384|LXL04_011384|OH1004|cDNA

ATGGCTGTAGAATCCGCGCTTGAAGGAATCGAAAGTGATGAAAATGTGTTGCAAAAGCACGTTGCGTTCTTTGATCGTAACAACGATGGTGTGATTTACCCATGGGAAACTTTTCAAGGGTTTCGAGCAATTGGGAGTGGTATTCTGCTATCCTCGGTGGCTGCTCTCTTCATCAATATGGGTCTCAGTGGCAAAACTCGACCTGGGAAGAAATTTCCTAATTTGCTCTTCCCAATTGAGATCCAAAACATAAGTATGGC...

CDS

Download CDS FASTA

1224 bp · LXL04_011384|LXL04_011384|OH1004|CDS

ATGGCTGTAGAATCCGCGCTTGAAGGAATCGAAAGTGATGAAAATGTGTTGCAAAAGCACGTTGCGTTCTTTGATCGTAACAACGATGGTGTGATTTACCCATGGGAAACTTTTCAAGGGTTTCGAGCAATTGGGAGTGGTATTCTGCTATCCTCGGTGGCTGCTCTCTTCATCAATATGGGTCTCAGTGGCAAAACTCGACCTGGGAAGAAATTTCCTAATTTGCTCTTCCCAATTGAGATCCAAAACATAAGTATGGC...

Protein

Download Protein FASTA

407 aa · LXL04_011384|LXL04_011384|OH1004|PROTEIN

MAVESALEGIESDENVLQKHVAFFDRNNDGVIYPWETFQGFRAIGSGILLSSVAALFINMGLSGKTRPGKKFPNLLFPIEIQNISMAKHGSDSGVYDTQGRFVSSKFEEIFAKYTRTNSDGLTADELKEFIKGNREPKDYGGWIGGFSEWKILYYLCKDEKGLLKKDVVRGVYDGSLFQKMAEEKEKAKAVKKKKHMVSSNWDWCYALLSGCSLNQYGSQWQNSFVPSKFEEIFAKYARTNPDGLTADEVNELIKRDREP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011384`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011384

Location Chr02:163595352-163602664 (-)

Description Similar to PXG4: Probable peroxygenase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70670`	Calcium-binding peroxygenase involved in the degradation of storage lipid in oil bodies.	No verified direct reference in this release
`At1g70680`	Calcium-binding peroxygenase involved in the degradation of storage lipid in oil bodies.	No verified direct reference in this release
`At1g23240`	Probable calcium-binding peroxygenase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011384 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0009819 drought recovery Biological Process

GO:0005811 lipid droplet Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:1990137 plant seed peroxygenase activity Molecular Function

KEGG gene cross-reference

ath:AT1G70670

ath:AT1G70680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.346

Rank 1 · LXL04_011384 · OH-1004

Endoplasmic reticulum0.236

Rank 2 · LXL04_011384 · OH-1004

Cell membrane0.153

Rank 3 · LXL04_011384 · OH-1004

Mitochondrion0.151

Rank 4 · LXL04_011384 · OH-1004

Nucleus0.124

Rank 5 · LXL04_011384 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05042.20Caleosin13-181 aa

PF05042.20Caleosin223-290 aa

PF05042.20Caleosin293-395 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011384	`PF05042.20`	Caleosin	13	181	1.1e-123	410.1
LXL04_011384	`PF05042.20`	Caleosin	223	290	1.1e-123	410.1
LXL04_011384	`PF05042.20`	Caleosin	293	395	1.1e-123	410.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAB7`	Arabidopsis thaliana	Probable peroxygenase 4	59.585%	Swiss-Prot	weak database homology
`Q9CAB8`	Arabidopsis thaliana	Probable peroxygenase 5	61.932%	Swiss-Prot	weak database homology
`B3H7A9`	Arabidopsis thaliana	Probable peroxygenase 7	57.485%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card