Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1128 bp · LXL04_011136|LXL04_011136|OH1004|cDNA
ATGGAAGAAGATAAAGGTGAAACTATCTCCACCACTACTACCACACCTGCAGATCTAGAACCAGCCTCCATTTCATCCCCTGATCATCCACTCAACAACGCTTATGGCTCACTAAACGATATCTGCTACGAACTATCCTCCCTTCAAGATCTCGCTTGCCGTGGCTCCTGGAAAACAATCCTCGACAAAGTTGCTCGAGCACGCACACAGTCTCTTCTTTCCAAACCTCACGAACACTTAATTTACCTCTCCTATAACAC...
1128 bp · LXL04_011136|LXL04_011136|OH1004|CDS
ATGGAAGAAGATAAAGGTGAAACTATCTCCACCACTACTACCACACCTGCAGATCTAGAACCAGCCTCCATTTCATCCCCTGATCATCCACTCAACAACGCTTATGGCTCACTAAACGATATCTGCTACGAACTATCCTCCCTTCAAGATCTCGCTTGCCGTGGCTCCTGGAAAACAATCCTCGACAAAGTTGCTCGAGCACGCACACAGTCTCTTCTTTCCAAACCTCACGAACACTTAATTTACCTCTCCTATAACAC...
Protein
Download Protein FASTA375 aa · LXL04_011136|LXL04_011136|OH1004|PROTEIN
MEEDKGETISTTTTTPADLEPASISSPDHPLNNAYGSLNDICYELSSLQDLACRGSWKTILDKVARARTQSLLSKPHEHLIYLSYNTIALTKLRRFSDAVTELDSLENGLDNVIYTYENYPDHYPNRHGSMVPFSLRWLYAELPSRVGNRQETLDRFYILLHFIRSKTANDQSTMSDDIWKKREGLVINSIISHHLSHKEFGVCLELIKDLIKRDSNPTARAVLMSKLGYIQMQLGDLEGAKVSFRTVEANLTEETIEMK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_011136 |
|---|---|
| TK1151 ID | TkAUNG061270 |
| OH-1004 ID | LXL04_011136 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 92.857 / OH-1004 62.400Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_011136 |
|---|---|
| Location | Chr02:158644865-158645992 (-) |
| Description | Similar to TRAPPC12: Trafficking protein particle complex subunit 12 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0007030 Golgi organization Biological Process GO:0048208 COPII vesicle coating Biological Process GO:0051310 metaphase chromosome alignment Biological Process GO:0090234 regulation of kinetochore assembly Biological Process GO:0099022 vesicle tethering Biological Process GO:1905342 positive regulation of protein localization to kinetochore Biological Process GO:0000776 kinetochore Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005793 endoplasmic reticulum-Golgi intermediate compartment Cellular Component |
| KEGG gene cross-reference | hsa:51112 mmu:217449 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.