LXL04_011046 | RubberDandelionOmics

Gene overview

LXL04_011046

Reference: OH-1004 Chr: Chr02 Coordinates: 156925965-156928201 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

930 bp · LXL04_011046|LXL04_011046|OH1004|cDNA

ATGGGTTTCTTAAAGATCTGCCCAGATCCGGCGACCTTTCCGCAAGCAACAGCAACAGAGACAGATGGAATTGAGCAATTTAAGTATGCGAATTCCGACTTTTCATCATTTGGTGAAAGAGGCAATTGGGTTTTTGGAATTGGGTTTCAACATAGGCAATCGAGTTTTAAGGAGCTCCAATACAGACGTGATGGAGATAGCAATGGAGTTCTATATTATGTCGGCACATCATATGGGAAACACCAATGGGTCAATCCTGT...

CDS

Download CDS FASTA

930 bp · LXL04_011046|LXL04_011046|OH1004|CDS

ATGGGTTTCTTAAAGATCTGCCCAGATCCGGCGACCTTTCCGCAAGCAACAGCAACAGAGACAGATGGAATTGAGCAATTTAAGTATGCGAATTCCGACTTTTCATCATTTGGTGAAAGAGGCAATTGGGTTTTTGGAATTGGGTTTCAACATAGGCAATCGAGTTTTAAGGAGCTCCAATACAGACGTGATGGAGATAGCAATGGAGTTCTATATTATGTCGGCACATCATATGGGAAACACCAATGGGTCAATCCTGT...

Protein

Download Protein FASTA

309 aa · LXL04_011046|LXL04_011046|OH1004|PROTEIN

MGFLKICPDPATFPQATATETDGIEQFKYANSDFSSFGERGNWVFGIGFQHRQSSFKELQYRRDGDSNGVLYYVGTSYGKHQWVNPVLAKKISITASNPISRYTDAKVLASRTYQGISFAGPRIEDGRSSWSMIDLGLDHQGSSDGKNWTNLRVHENDQTLSKPGQFASWAVTGPNALLPFRYFRKYEMLIKKDPFMKAEEGKESVADVASRLTNVLLQIESQFQECAILIVSHGDPLQILQTVLDAFGEKVGPEDGGLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011046`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011046

Location Chr02:156925965-156928201 (+)

Description Similar to At2g30600/At2g30610: BTB/POZ domain-containing protein At2g30600

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q8LEV3`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011046 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0042659 regulation of cell fate specification Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0045746 negative regulation of Notch signaling pathway Biological Process

GO:0045747 positive regulation of Notch signaling pathway Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0070373 negative regulation of ERK1 and ERK2 cascade Biological Process

GO:0070534 protein K63-linked ubiquitination Biological Process

GO:1902882 regulation of response to oxidative stress Biological Process

KEGG gene cross-reference

ath:AT2G30600

cel:CELE_C34D4.14

dme:Dmel_CG5604

hsa:25831

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.337

Rank 1 · LXL04_011046 · OH-1004

Nucleus0.270

Rank 2 · LXL04_011046 · OH-1004

Mitochondrion0.219

Rank 3 · LXL04_011046 · OH-1004

Plastid0.149

Rank 4 · LXL04_011046 · OH-1004

Peroxisome0.070

Rank 5 · LXL04_011046 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LEV3`	Arabidopsis thaliana	BTB/POZ domain-containing protein At2g30600	63.354%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card