LXL04_010621 | RubberDandelionOmics

Gene overview

LXL04_010621

Reference: OH-1004 Chr: Chr02 Coordinates: 149725715-149726927 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

660 bp · LXL04_010621|LXL04_010621|OH1004|cDNA

ATGGGTTCTGTTGTTGAAGCTGCCAACAAGGAAGCAAGTGGAAGTTCTCTTAGTCAAAAGAAGCCCAAGGTTGTATTTGTCCTAGGAGGCCCAGGGAGTGGTAAGGGTACCCAATGTGCAAATATTGTGGAACACTTTGGGTACACTCATCTCAGTGCTGGTGATCTTCTTCGGGCAGAAATTAAATCTGGGTCAGAAAACGGGACCATGATTCAGAACATGATCAAGGAGGGAAAAATCGTTCCTTCAGAAGTAACAAT...

CDS

Download CDS FASTA

660 bp · LXL04_010621|LXL04_010621|OH1004|CDS

ATGGGTTCTGTTGTTGAAGCTGCCAACAAGGAAGCAAGTGGAAGTTCTCTTAGTCAAAAGAAGCCCAAGGTTGTATTTGTCCTAGGAGGCCCAGGGAGTGGTAAGGGTACCCAATGTGCAAATATTGTGGAACACTTTGGGTACACTCATCTCAGTGCTGGTGATCTTCTTCGGGCAGAAATTAAATCTGGGTCAGAAAACGGGACCATGATTCAGAACATGATCAAGGAGGGAAAAATCGTTCCTTCAGAAGTAACAAT...

Protein

Download Protein FASTA

219 aa · LXL04_010621|LXL04_010621|OH1004|PROTEIN

MGSVVEAANKEASGSSLSQKKPKVVFVLGGPGSGKGTQCANIVEHFGYTHLSAGDLLRAEIKSGSENGTMIQNMIKEGKIVPSEVTIKLLEKAILENENDKFLIDGFPRNEENRAAFESVTGITPEFVLFFDCPQEEMEKRLLGRNQGREDDNIETIRKRFKVFLESSLPVIEYYNSKEKVRKIDAAKPVGEVFEAVKALFTPVVDTVKQVIIIPLNFN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010621`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010621

Location Chr02:149725715-149726927 (+)

Description Similar to UMK3: UMP-CMP kinase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26667`	Catalyzes the phosphorylation of pyrimidine nucleoside monophosphates at the expense of ATP.	No verified direct reference in this release
`At3g60180`	Catalyzes the phosphorylation of pyrimidine nucleoside monophosphates at the expense of ATP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0624700`	Catalyzes the phosphorylation of pyrimidine nucleoside monophosphates at the expense of ATP.	No verified direct reference in this release
`Os02g0778400`	Catalyzes the phosphorylation of pyrimidine nucleoside monophosphates at the expense of ATP.	No verified direct reference in this release
`Os06g0109600`	Catalyzes the phosphorylation of pyrimidine nucleoside monophosphates at the expense of ATP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010621 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006207 'de novo' pyrimidine nucleobase biosynthetic process Biological Process

GO:0006221 pyrimidine nucleotide biosynthetic process Biological Process

GO:0006225 UDP biosynthetic process Biological Process

GO:0009173 pyrimidine ribonucleoside monophosphate metabolic process Biological Process

GO:0046705 CDP biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0033862 UMP kinase activity Molecular Function

GO:0036430 CMP kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G60180

ath:AT5G26667

dosa:Os02g0778400

dosa:Os06g0109600

dosa:Os07g0624700

osa:4339882

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.623

Rank 1 · LXL04_010621 · OH-1004

Nucleus0.288

Rank 2 · LXL04_010621 · OH-1004

Mitochondrion0.170

Rank 3 · LXL04_010621 · OH-1004

Cell membrane0.136

Rank 4 · LXL04_010621 · OH-1004

Endoplasmic reticulum0.083

Rank 5 · LXL04_010621 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13671.13AAA_3324-161 aa

PF13238.13AAA_1825-152 aa

PF00406.30ADK27-179 aa

PF13207.13AAA_1728-158 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010621	`PF13671.13`	AAA_33	24	161	2.5e-06	28.6
LXL04_010621	`PF13238.13`	AAA_18	25	152	9.3e-09	36.6
LXL04_010621	`PF00406.30`	ADK	27	179	3e-49	167.7
LXL04_010621	`PF13207.13`	AAA_17	28	158	5.6e-37	127.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04905`	Arabidopsis thaliana	UMP-CMP kinase 3	81.340%	Swiss-Prot	strong database homology
`Q8VY84`	Arabidopsis thaliana	Probable UMP-CMP kinase 1	69.802%	Swiss-Prot	strong database homology
`Q7XI40`	Oryza sativa subsp. japonica	UMP-CMP kinase 3	80.000%	Swiss-Prot	strong database homology
`Q6K7H2`	Oryza sativa subsp. japonica	UMP-CMP kinase 4	78.846%	Swiss-Prot	strong database homology
`Q5VRN0`	Oryza sativa subsp. japonica	UMP-CMP kinase 1	62.703%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card