LXL04_008372 | RubberDandelionOmics

Gene overview

LXL04_008372

Reference: OH-1004 Chr: Chr02 Coordinates: 97511672-97514513 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1899 bp · LXL04_008372|LXL04_008372|OH1004|cDNA

ATGGCGTCGTACCGACCATTCCCTCCACCGCCACCCCAATCAAAATTTGGTCCTCCGCCACCCAATCAGACTTCCCTCCCACCTCCCCAACTCGCCCCTGTTCCCCAACCGAGAGGAAATATGTTCTCACAGAATTGGAGCTATCCTAATTCGAATTTTCAACAGAGTGTTTATCCCGCTCCACCAAGACCACCTGTTCCAAATCCGCAACAACAGTATTCATCATatccacctccaccaccaccgccgctgGAGTCTTC...

CDS

Download CDS FASTA

1899 bp · LXL04_008372|LXL04_008372|OH1004|CDS

ATGGCGTCGTACCGACCATTCCCTCCACCGCCACCCCAATCAAAATTTGGTCCTCCGCCACCCAATCAGACTTCCCTCCCACCTCCCCAACTCGCCCCTGTTCCCCAACCGAGAGGAAATATGTTCTCACAGAATTGGAGCTATCCTAATTCGAATTTTCAACAGAGTGTTTATCCCGCTCCACCAAGACCACCTGTTCCAAATCCGCAACAACAGTATTCATCATATCCACCTCCACCACCACCGCCGCTGGAGTCTTC...

Protein

Download Protein FASTA

632 aa · LXL04_008372|LXL04_008372|OH1004|PROTEIN

MASYRPFPPPPPQSKFGPPPPNQTSLPPPQLAPVPQPRGNMFSQNWSYPNSNFQQSVYPAPPRPPVPNPQQQYSSYPPPPPPPLESSYPPPPPPSQPPRPGQIYFPSSQNLLLNNQPPPPSSPPNSSIPPPPPPPPSHPTSPPLPPSSVSATNQTQNHKESSKRDSHHKVPSKPSFLPPIPARTSNRAETEEERRIRKKREIEEKQRHHLKESRTLSSSIKPHGSVTGSHIGERAENRLKKPTTFLCKLKFRDELPDPTA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008372`
TK1151 ID	TkA03G380270
OH-1004 ID	LXL04_008372
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008372

Location Chr02:97511672-97514513 (+)

Description Similar to VIP2: Protein PAF1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79730`	Component of the PAF1 complex (PAF1C) which is involved in histone modifications such as methylation on histone H3 'Lys-4' (H3K4me3).	PAF1-complex-mediated histone methylation of FLOWERING LOCUS C chromatin is required for the vernalization-responsive, winter-annual habit in Arabidopsis.2004 · DOI: 10.1101/gad.1244504 Identification of the Arabidopsis REDUCED DORMANCY 2 gene uncovers a role for the polymerase associated factor 1 complex in seed dormancy.2011 · DOI: 10.1371/journal.pone.0022241

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008372 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006368 transcription elongation by RNA polymerase II Biological Process

GO:0009908 flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010467 gene expression Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0019827 stem cell population maintenance Biological Process

GO:0031124 mRNA 3'-end processing Biological Process

GO:0034504 protein localization to nucleus Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0071222 cellular response to lipopolysaccharide Biological Process

KEGG gene cross-reference

ath:AT1G79730

hsa:54623

mmu:54624

pon:100172552

rno:361531

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.975

Rank 1 · LXL04_008372 · OH-1004

Cytoplasm0.132

Rank 2 · LXL04_008372 · OH-1004

Cell membrane0.013

Rank 3 · LXL04_008372 · OH-1004

Mitochondrion0.009

Rank 4 · LXL04_008372 · OH-1004

Endoplasmic reticulum0.007

Rank 5 · LXL04_008372 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03985.19Paf1245-618 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008372	`PF03985.19`	Paf1	245	618	5.1e-55	187.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HQA1`	Arabidopsis thaliana	Protein PAF1 homolog	62.955%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card