LXL04_006205 | RubberDandelionOmics

Gene overview

LXL04_006205

Reference: OH-1004 Chr: Chr02 Coordinates: 3781777-3793732 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3777 bp · LXL04_006205|LXL04_006205|OH1004|cDNA

ATGGATCTTCAGGAAGAATGTCTATTCTGGGGCCATATGAGATCCACCAATTTttataATACTGCTTCCATGATCATACTGTGTGAACTTTACAGGATTACAACCAGAAGAGCTATTAAATGGGATGAAATAAAATTTCCAGAAAATTGGATTATAGAAAATAATACTCCTCCAAAACCCTTAGTAAACAATAATATTGAAAATAGTGAATCAGAAGATGATAATATTCAAATTAATAGAATAAATTCTTATGATAGCAA...

CDS

Download CDS FASTA

3777 bp · LXL04_006205|LXL04_006205|OH1004|CDS

ATGGATCTTCAGGAAGAATGTCTATTCTGGGGCCATATGAGATCCACCAATTTTTATAATACTGCTTCCATGATCATACTGTGTGAACTTTACAGGATTACAACCAGAAGAGCTATTAAATGGGATGAAATAAAATTTCCAGAAAATTGGATTATAGAAAATAATACTCCTCCAAAACCCTTAGTAAACAATAATATTGAAAATAGTGAATCAGAAGATGATAATATTCAAATTAATAGAATAAATTCTTATGATAGCAA...

Protein

Download Protein FASTA

1258 aa · LXL04_006205|LXL04_006205|OH1004|PROTEIN

MDLQEECLFWGHMRSTNFYNTASMIILCELYRITTRRAIKWDEIKFPENWIIENNTPPKPLVNNNIENSESEDDNIQINRINSYDSKFARKPVQRLYYYPRPSPQDVLHEEQEYEINNSYSGKNVYEWNLDGYSERQIYNMVHRMLMYTTIAKNAGNNEKQIAAMIIAGFTGQLKGWWDNYLNLEGQQAILATTKTEDGVNTPNVVYTLTCTIIEHFTGRWSDNSENIRTLLNGMFCKTLTSFRWYKDTFLSRVMELNDC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006205`
TK1151 ID	TkA06G297530
OH-1004 ID	LXL04_006205
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	94.200
Protein coverage (%)	TK1151 100.000 / OH-1004 86.963 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_006205`
Location	Chr02:3781777-3793732 (-)
Description	Similar to ORF V: Enzymatic polyprotein (Cauliflower mosaic virus (strain D/H)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006205` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004519 endonuclease activity Molecular Function
KEGG gene cross-reference	vg:1489542 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.580

Rank 1 · LXL04_006205 · OH-1004

Nucleus0.363

Rank 2 · LXL04_006205 · OH-1004

Mitochondrion0.092

Rank 3 · LXL04_006205 · OH-1004

Cell membrane0.051

Rank 4 · LXL04_006205 · OH-1004

Endoplasmic reticulum0.029

Rank 5 · LXL04_006205 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24925.2DUF7746120-206 aa

PF22909.2Caulimovir_coat_dom231-326 aa

PF00077.26RVP639-721 aa

PF00078.33RVT_1881-1036 aa

PF17919.8RT_RNaseH_21099-1199 aa

PF17917.8RT_RNaseH1127-1233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006205	`PF24925.2`	DUF7746	120	206	9.2e-37	125.8
LXL04_006205	`PF22909.2`	Caulimovir_coat_dom	231	326	2.2e-07	31.9
LXL04_006205	`PF00077.26`	RVP	639	721	3.4e-07	31.2
LXL04_006205	`PF00078.33`	RVT_1	881	1036	4.9e-37	128.5
LXL04_006205	`PF17919.8`	RT_RNaseH_2	1099	1199	1.1e-28	100.0
LXL04_006205	`PF17917.8`	RT_RNaseH	1127	1233	2.9e-24	85.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card