LXL04_005954 | RubberDandelionOmics

Gene overview

LXL04_005954

Reference: OH-1004 Chr: Chr01 Coordinates: 176301366-176302322 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

957 bp · LXL04_005954|LXL04_005954|OH1004|cDNA

ATGTCTATCCCAAAATCCTCTTCTAAGCTTCAATCCACTGAAGCCAACTCTCATATCGACATGGGGTTTACAATACTACAAAGAAACACATCCATTCCTCAACCAACAGAAAGAAGAGGCCGGAAAAAGGAGGCGGAGCCAGGGCGGTTCCTTGGTGTCAGGAGGCGGCCGTGGGGAAGATATGCGGCTGAAATAAGAGACCCCACAACCAAAGAACGACATTGGCTTGGAACATTTGATACTGCCCAAGAAGCTGCCCT...

CDS

Download CDS FASTA

957 bp · LXL04_005954|LXL04_005954|OH1004|CDS

ATGTCTATCCCAAAATCCTCTTCTAAGCTTCAATCCACTGAAGCCAACTCTCATATCGACATGGGGTTTACAATACTACAAAGAAACACATCCATTCCTCAACCAACAGAAAGAAGAGGCCGGAAAAAGGAGGCGGAGCCAGGGCGGTTCCTTGGTGTCAGGAGGCGGCCGTGGGGAAGATATGCGGCTGAAATAAGAGACCCCACAACCAAAGAACGACATTGGCTTGGAACATTTGATACTGCCCAAGAAGCTGCCCT...

Protein

Download Protein FASTA

318 aa · LXL04_005954|LXL04_005954|OH1004|PROTEIN

MSIPKSSSKLQSTEANSHIDMGFTILQRNTSIPQPTERRGRKKEAEPGRFLGVRRRPWGRYAAEIRDPTTKERHWLGTFDTAQEAALAYDRAALSMKGTQARTNFIYTTDHDHNNTNFHTLISPLDVQTLFQPPQLFNPPPPPPPPTHTTKQPINPTINIPHNPNQSGIDTRHQSSIDDHNDFFISEGDNSGYLGSIVPDDYLNPRSSNASNVNISTHDDNQSHSYWDQSNQLFGSNEEVYGGAWGGSTDSSWETFNGYD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005954`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005954

Location Chr01:176301366-176302322 (+)

Description Similar to ERF086: Ethylene-responsive transcription factor ERF086

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18560`	Probably acts as a transcriptional activator.	The auxin-regulated AP2/EREBP gene PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis.2007 · DOI: 10.1105/tpc.107.050674 A role for Arabidopsis PUCHI in floral meristem identity and bract suppression.2009 · DOI: 10.1105/tpc.109.067025 The AP2/EREBP gene PUCHI Co-Acts with LBD16/ASL18 and LBD18/ASL20 downstream of ARF7 and ARF19 to regulate lateral root development in Arabidopsis.2013 · DOI: 10.1093/pcp/pct081
`At5g13910`	Cell division-promoting factor involved in leaf blade differentiation, inflorescence branching, as well as in carpel and silique shape.	No verified direct reference in this release
`At1g28160`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At1g12890`	Probably acts as a transcriptional activator.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0669500`	Required to prevent the formation of axillary meristems within the spikelet meristem and permit the subsequent establishment of floral meristem identity.	Ds tagging of BRANCHED FLORETLESS 1 (BFL1) that mediates the transition from spikelet to floret meristem in rice (Oryza sativa L).2003 · DOI: 10.1186/1471-2229-3-6

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005954 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0010432 bract development Biological Process

GO:0010451 floral meristem growth Biological Process

GO:0010582 floral meristem determinacy Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:1901332 negative regulation of lateral root development Biological Process

KEGG gene cross-reference

ath:AT1G12890

ath:AT1G28160

ath:AT5G13910

ath:AT5G18560

dosa:Os07g0669500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.966

Rank 1 · LXL04_005954 · OH-1004

Cytoplasm0.097

Rank 2 · LXL04_005954 · OH-1004

Endoplasmic reticulum0.028

Rank 3 · LXL04_005954 · OH-1004

Cell membrane0.028

Rank 4 · LXL04_005954 · OH-1004

Plastid0.018

Rank 5 · LXL04_005954 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00847.27AP251-98 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005954	`PF00847.27`	AP2	51	98	6.1e-13	49.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6J9Q2`	Arabidopsis thaliana	Ethylene-responsive transcription factor ERF086	48.485%	Swiss-Prot	moderate database homology
`Q9M644`	Arabidopsis thaliana	Ethylene-responsive transcription factor LEP	75.676%	Swiss-Prot	weak database homology
`Q9FZ90`	Arabidopsis thaliana	Ethylene-responsive transcription factor ERF087	58.947%	Swiss-Prot	weak database homology
`Q3E703`	Arabidopsis thaliana	Ethylene-responsive transcription factor ERF088	67.606%	Swiss-Prot	weak database homology
`Q8H3Q1`	Oryza sativa subsp. japonica	Ethylene-responsive transcription factor FZP	39.259%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card