LXL04_005931 | RubberDandelionOmics

Gene overview

LXL04_005931

Reference: OH-1004 Chr: Chr01 Coordinates: 175888111-175888944 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

834 bp · LXL04_005931|LXL04_005931|OH1004|cDNA

ATGGCAGCAGCTGCAGAAACCTTGAAATGCGAGGATCTTAAACCAATCGAAGATGACTGGACAATCGTCATACGAAAACGCACAAATCAGAAACGAAAATTCCCCAAACTCAAACCCTCAAAACAACAAGAACAACAAACACAGTGGGCGCCAACAGACATCGAAACAACTCCAGAAAAAGAACTCAAATTGATGCATAAAATCCAAATCTCAATTGAAAAACTAGAGAAGTCCCAATTTTTCACTGCTTTTCTGGATCA...

CDS

Download CDS FASTA

834 bp · LXL04_005931|LXL04_005931|OH1004|CDS

ATGGCAGCAGCTGCAGAAACCTTGAAATGCGAGGATCTTAAACCAATCGAAGATGACTGGACAATCGTCATACGAAAACGCACAAATCAGAAACGAAAATTCCCCAAACTCAAACCCTCAAAACAACAAGAACAACAAACACAGTGGGCGCCAACAGACATCGAAACAACTCCAGAAAAAGAACTCAAATTGATGCATAAAATCCAAATCTCAATTGAAAAACTAGAGAAGTCCCAATTTTTCACTGCTTTTCTGGATCA...

Protein

Download Protein FASTA

277 aa · LXL04_005931|LXL04_005931|OH1004|PROTEIN

MAAAAETLKCEDLKPIEDDWTIVIRKRTNQKRKFPKLKPSKQQEQQTQWAPTDIETTPEKELKLMHKIQISIEKLEKSQFFTAFLDQIRTPEASQHFENITESKRKLKMVIYGIGSIESYESPRLQLSLAILMKKNLEWIGDMEVFDPIISLTESKVMEELGVRVLSVNEQGKREVVDPILFFMPHCEVELYDNLLKTNWKHELLNKIILLGNSFDKYEQQHRLVSKNQDLDDSRKHLLAIKRFTKEFEIRTISDDFFRA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005931`
TK1151 ID	TkA01G006360
OH-1004 ID	LXL04_005931
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005931

Location Chr01:175888111-175888944 (+)

Description Similar to SRR1: Protein SENSITIVITY TO RED LIGHT REDUCED 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g59560`	Probable regulator involved in a circadian clock input pathway, which is required for normal oscillator function.	The Arabidopsis SRR1 gene mediates phyB signaling and is required for normal circadian clock function.2003 · DOI: 10.1101/gad.244103

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005931 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006783 heme biosynthetic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0042752 regulation of circadian rhythm Biological Process

GO:0048511 rhythmic process Biological Process

GO:0070453 regulation of heme biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT5G59560

dme:Dmel_CG7988

hsa:402055

mmu:70118

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.557

Rank 1 · LXL04_005931 · OH-1004

Nucleus0.504

Rank 2 · LXL04_005931 · OH-1004

Mitochondrion0.062

Rank 3 · LXL04_005931 · OH-1004

Cell membrane0.044

Rank 4 · LXL04_005931 · OH-1004

Endoplasmic reticulum0.042

Rank 5 · LXL04_005931 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07985.19SRR195-268 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005931	`PF07985.19`	SRR1	95	268	4.8e-42	144.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GWZ6`	Arabidopsis thaliana	Protein SENSITIVITY TO RED LIGHT REDUCED 1	50.190%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card