LXL04_005891 | RubberDandelionOmics

Gene overview

LXL04_005891

Reference: OH-1004 Chr: Chr01 Coordinates: 175255810-175258288 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1050 bp · LXL04_005891|LXL04_005891|OH1004|cDNA

ATGTCTACAGAGATATGCATCGTTTGTGATGAAGCTATTGATCCAGGTGAAAATTTGTCAATTGATGGAGTTTCCTATCATAGCGAATGTTTCCAATGCAGCCAATGTGACGAAAAGCTTTTGGAAAACGATTACTCCTCGTTTGATGGGATCTTATATTGCAAGCCTCATTTTGAGCAAACATTTCAGAAAAATGGAAGGATTCCAAGAGAACTATCTTTGCCTAAACCCAGTGAACTAATAGATGCACGTGCAACAAT...

CDS

Download CDS FASTA

1050 bp · LXL04_005891|LXL04_005891|OH1004|CDS

ATGTCTACAGAGATATGCATCGTTTGTGATGAAGCTATTGATCCAGGTGAAAATTTGTCAATTGATGGAGTTTCCTATCATAGCGAATGTTTCCAATGCAGCCAATGTGACGAAAAGCTTTTGGAAAACGATTACTCCTCGTTTGATGGGATCTTATATTGCAAGCCTCATTTTGAGCAAACATTTCAGAAAAATGGAAGGATTCCAAGAGAACTATCTTTGCCTAAACCCAGTGAACTAATAGATGCACGTGCAACAAT...

Protein

Download Protein FASTA

349 aa · LXL04_005891|LXL04_005891|OH1004|PROTEIN

MSTEICIVCDEAIDPGENLSIDGVSYHSECFQCSQCDEKLLENDYSSFDGILYCKPHFEQTFQKNGRIPRELSLPKPSELIDARATISNANDNDDDDGDDEEYEDASSPSFLTPTDQTHPLANSQLDPNMIMNQFMQNPALIGVLDGIPNQTEMESPDFLRNMMDQITRNPEMMTAINQLGQQMVDNQNLGSMFASMTGSHSYDGDGGPDCDGGDLDMSFMVQQMMPFFSQSFHCEEDTSLNLLEHSLPPKPKVHRRCYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005891`
TK1151 ID	TkA01G009300
OH-1004 ID	LXL04_005891
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 63.037 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005891

Location Chr01:175255810-175258288 (+)

Description Similar to WLIN2A: LIM domain-containing protein WLIM2a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39900`	Binds to actin filaments and promotes cross-linking into thick bundles.	No verified direct reference in this release
`At3g55770`	Binds to actin filaments and promotes cross-linking into thick bundles.	Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns and modes of regulation.2010 · DOI: 10.1105/tpc.110.075960
`At2g45800`	Binds to actin filaments and promotes cross-linking into thick bundles.	Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns and modes of regulation.2010 · DOI: 10.1105/tpc.110.075960
`At3g61230`	Binds to actin filaments and promotes cross-linking into thick bundles.	Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns and modes of regulation.2010 · DOI: 10.1105/tpc.110.075960
`At1g01780`	Binds to actin filaments and promotes cross-linking into thick bundles.	Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns and modes of regulation.2010 · DOI: 10.1105/tpc.110.075960

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005891 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0051017 actin filament bundle assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051015 actin filament binding Molecular Function

KEGG gene cross-reference

ath:AT2G39900

ath:AT2G45800

ath:AT3G55770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.563

Rank 1 · LXL04_005891 · OH-1004

Nucleus0.456

Rank 2 · LXL04_005891 · OH-1004

Mitochondrion0.076

Rank 3 · LXL04_005891 · OH-1004

Cell membrane0.061

Rank 4 · LXL04_005891 · OH-1004

Endoplasmic reticulum0.051

Rank 5 · LXL04_005891 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00412.29LIM6-62 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005891	`PF00412.29`	LIM	6	62	1.7e-12	48.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04193`	Arabidopsis thaliana	LIM domain-containing protein WLIM2a	44.286%	Swiss-Prot	weak database homology
`Q9M047`	Arabidopsis thaliana	LIM domain-containing protein WLIM2b	43.836%	Swiss-Prot	weak database homology
`O80839`	Arabidopsis thaliana	LIM domain-containing protein PLIM2a	40.845%	Swiss-Prot	weak database homology
`Q500W4`	Arabidopsis thaliana	LIM domain-containing protein PLIM2c	37.179%	Swiss-Prot	weak database homology
`Q1ECF5`	Arabidopsis thaliana	LIM domain-containing protein PLIM2b	44.776%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card