LXL04_005570 | RubberDandelionOmics

Gene overview

LXL04_005570

Reference: OH-1004 Chr: Chr01 Coordinates: 168537603-168546518 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5616 bp · LXL04_005570|LXL04_005570|OH1004|cDNA

ATGGCTGAAATCGTTGTTAGCGCCGTCATCACCGCACTGTGTGAAAGGCTGATCTCTGGAGACTTGTTGAAGCTGGCTCGATTAGAAGGGATCGATTCTCAGCTACACAAATTGAAGAAAAACTTGCTCATGATCCAAGCGGTGCTTGCTGATGCAAGCCAGAAGCACATAACCGACAGAGCTGTTCAACTGTGGGTGACTGAGCTCCAGGAATTGGCTTACGACATAGATGATGTACTTGATGATTTGGCTACCGAAGA...

CDS

Download CDS FASTA

5616 bp · LXL04_005570|LXL04_005570|OH1004|CDS

ATGGCTGAAATCGTTGTTAGCGCCGTCATCACCGCACTGTGTGAAAGGCTGATCTCTGGAGACTTGTTGAAGCTGGCTCGATTAGAAGGGATCGATTCTCAGCTACACAAATTGAAGAAAAACTTGCTCATGATCCAAGCGGTGCTTGCTGATGCAAGCCAGAAGCACATAACCGACAGAGCTGTTCAACTGTGGGTGACTGAGCTCCAGGAATTGGCTTACGACATAGATGATGTACTTGATGATTTGGCTACCGAAGA...

Protein

Download Protein FASTA

1871 aa · LXL04_005570|LXL04_005570|OH1004|PROTEIN

MAEIVVSAVITALCERLISGDLLKLARLEGIDSQLHKLKKNLLMIQAVLADASQKHITDRAVQLWVTELQELAYDIDDVLDDLATEDIRRKLNQEDSASISNITGKVLKLFPNCCTNFTPRNITGLAKLREVSTKLRDLVDQKKDLGLNVNVGRSNERERRQEETSLVDESKIMGREGDKEALLEKLLGNEECVENVSIVSIVGMGGIGKTTLAKLLYNDEKVKKHFKLKAWVCVSEELDVFTVSKAIFQAVTGENKDFV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005570`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005570

Location Chr01:168537603-168546518 (+)

Description Similar to KIN14K: Kinesin-like protein KIN-14K

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g41310`	Kinesin-like protein KIN-14K.	No verified direct reference in this release
`At1g63640`	Kinesin-like protein KIN-14J.	No verified direct reference in this release
`At3g14470`	Potential disease resistance protein.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0744000`	Kinesin-like protein KIN-14C.	No verified direct reference in this release
`Os05g0521300`	Kinesin-like protein KIN-14K.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005570 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007017 microtubule-based process Biological Process

GO:0007018 microtubule-based movement Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005874 microtubule Cellular Component

GO:0015630 microtubule cytoskeleton Cellular Component

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT1G63640

ath:AT3G14470

ath:AT5G41310

dosa:Os01g0744000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.432

Rank 1 · LXL04_005570 · OH-1004

Cytoplasm0.307

Rank 2 · LXL04_005570 · OH-1004

Nucleus0.229

Rank 3 · LXL04_005570 · OH-1004

Plastid0.082

Rank 4 · LXL04_005570 · OH-1004

Endoplasmic reticulum0.067

Rank 5 · LXL04_005570 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18052.7Rx_N5-94 aa

PF00931.29NB-ARC177-347 aa

PF23559.2WHD_DRP434-502 aa

PF23598.2LRR_14575-909 aa

PF25013.1LRR_Zer-1612-672 aa

PF25019.1LRR_R13L1-DRL21704-830 aa

PF23247.2LRR_RPS2870-989 aa

PF23247.2LRR_RPS2925-1021 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005570	`PF18052.7`	Rx_N	5	94	7.5e-20	71.6
LXL04_005570	`PF00931.29`	NB-ARC	177	347	4.1e-36	124.9
LXL04_005570	`PF23559.2`	WHD_DRP	434	502	1.2e-23	83.6
LXL04_005570	`PF23598.2`	LRR_14	575	909	1.1e-27	97.4
LXL04_005570	`PF25013.1`	LRR_Zer-1	612	672	2.7e-07	31.5
LXL04_005570	`PF25019.1`	LRR_R13L1-DRL21	704	830	1.8e-40	138.5
LXL04_005570	`PF23247.2`	LRR_RPS2	870	989	1.1e-13	52.2
LXL04_005570	`PF23247.2`	LRR_RPS2	925	1021	1.1e-13	52.2
LXL04_005570	`PF16796.12`	Microtub_bd	1390	1551	2.6e-45	154.8
LXL04_005570	`PF00225.30`	Kinesin	1411	1660	8.5e-75	252.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JX00`	Arabidopsis thaliana	Kinesin-like protein KIN-14K	48.669%	Swiss-Prot	weak database homology
`B3H6Z8`	Arabidopsis thaliana	Kinesin-like protein KIN-14J	54.660%	Swiss-Prot	weak database homology
`Q9LRR4`	Arabidopsis thaliana	Putative disease resistance RPP13-like protein 1	37.365%	Swiss-Prot	moderate database homology
`Q5JKW1`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-14C	49.530%	Swiss-Prot	weak database homology
`B9FL70`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-14K	48.746%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card