LXL04_004049 | RubberDandelionOmics

Gene overview

LXL04_004049

Reference: OH-1004 Chr: Chr01 Coordinates: 123406955-123412274 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2973 bp · LXL04_004049|LXL04_004049|OH1004|cDNA

ATGGCCGCGACTACGGTGAGTTCGGCAGGCGGTCTTTTAGCGATGCTTAACGAGCCGCATCCGTCTCTCAAGTTGCATGCTCTTTCAAATCTTAACGCCTTTGTCGACTACTTCTGGCCCGAGATCTCAACTAGCGTCCCAATAATTGAGAGTTTATATGAAGACGAAGAGTTTGATCAAAGACAGTTGGCTGCTTTACTTGTTTCAAAGGTTTTCTATTATCTGGGAGAGCTTAATGACTCATTATCGTACGCCCTTGG...

CDS

Download CDS FASTA

2973 bp · LXL04_004049|LXL04_004049|OH1004|CDS

ATGGCCGCGACTACGGTGAGTTCGGCAGGCGGTCTTTTAGCGATGCTTAACGAGCCGCATCCGTCTCTCAAGTTGCATGCTCTTTCAAATCTTAACGCCTTTGTCGACTACTTCTGGCCCGAGATCTCAACTAGCGTCCCAATAATTGAGAGTTTATATGAAGACGAAGAGTTTGATCAAAGACAGTTGGCTGCTTTACTTGTTTCAAAGGTTTTCTATTATCTGGGAGAGCTTAATGACTCATTATCGTACGCCCTTGG...

Protein

Download Protein FASTA

990 aa · LXL04_004049|LXL04_004049|OH1004|PROTEIN

MAATTVSSAGGLLAMLNEPHPSLKLHALSNLNAFVDYFWPEISTSVPIIESLYEDEEFDQRQLAALLVSKVFYYLGELNDSLSYALGAGSLFDVSEDSDYVHTLLAKAIDEYATLRTKAAESKEESSDVDPRLEAIVERMLDKCITDGKYQQAIGMSIECRRLDKLKEAITNSDNVHATLAYCMNVSHAFVNRREYRREVLLLLVKVYQDLASPDYLNICQCLMFLDQPEGVASILEKLLRSENKDDAMMAFQIAFDLIE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004049`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004049

Location Chr01:123406955-123412274 (-)

Description Similar to RPN2A: 26S proteasome non-ATPase regulatory subunit 1 homolog A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g32730`	Acts as a regulatory subunit of the 26S proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins.	No verified direct reference in this release
`At1g04810`	Acts as a regulatory subunit of the 26S proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004049 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0042176 regulation of protein catabolic process Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0061136 regulation of proteasomal protein catabolic process Biological Process

GO:0071357 cellular response to type I interferon Biological Process

GO:0000502 proteasome complex Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G04810

ath:AT2G32730

hsa:5707

mmu:70247

pon:100173695

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.508

Rank 1 · LXL04_004049 · OH-1004

Nucleus0.507

Rank 2 · LXL04_004049 · OH-1004

Golgi apparatus0.066

Rank 3 · LXL04_004049 · OH-1004

Endoplasmic reticulum0.052

Rank 4 · LXL04_004049 · OH-1004

Lysosome / Vacuole0.036

Rank 5 · LXL04_004049 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21505.4RPN2_N8-354 aa

PF17781.8RPN1_RPN2_N69-257 aa

PF01851.29PC_rep488-521 aa

PF13646.13HEAT_2611-703 aa

PF01851.29PC_rep662-695 aa

PF18004.7RPN2_C797-952 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004049	`PF21505.4`	RPN2_N	8	354	1.2e-91	307.9
LXL04_004049	`PF17781.8`	RPN1_RPN2_N	69	257	5e-06	27.0
LXL04_004049	`PF01851.29`	PC_rep	488	521	6.2e-31	105.9
LXL04_004049	`PF13646.13`	HEAT_2	611	703	1.4e-19	70.8
LXL04_004049	`PF01851.29`	PC_rep	662	695	6.2e-31	105.9
LXL04_004049	`PF18004.7`	RPN2_C	797	952	1.2e-47	162.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O48844`	Arabidopsis thaliana	26S proteasome non-ATPase regulatory subunit 1 homolog A	83.399%	Swiss-Prot	strong database homology
`Q9MAT0`	Arabidopsis thaliana	26S proteasome non-ATPase regulatory subunit 1 homolog B	82.656%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card