LXL04_002847 | RubberDandelionOmics

Gene overview

LXL04_002847

Reference: OH-1004 Chr: Chr01 Coordinates: 59624516-59629722 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1059 bp · LXL04_002847|LXL04_002847|OH1004|cDNA

ATGTACTCTGTGAGCGCGCCTTTAATGGGCTCAGCCTTTGCTAGGGTTCCTTTCACACAGAAGTCAGGGAATATGTTGAAtttttgtccttctacaagaaTTAGCAACAACGGTGTTGCGTCGATGGTAACAAGTGTTTTACGCCGTGGTTCATCTTCTATTCACACCTTTAAGGCAAAGGCCATGAGCAAGGAAGAAAGTGAACCACGATTTCCACCACAGAATCAAGATAGCCAACCTGGAAAAGAATATCTCATGGA...

CDS

Download CDS FASTA

1059 bp · LXL04_002847|LXL04_002847|OH1004|CDS

ATGTACTCTGTGAGCGCGCCTTTAATGGGCTCAGCCTTTGCTAGGGTTCCTTTCACACAGAAGTCAGGGAATATGTTGAATTTTTGTCCTTCTACAAGAATTAGCAACAACGGTGTTGCGTCGATGGTAACAAGTGTTTTACGCCGTGGTTCATCTTCTATTCACACCTTTAAGGCAAAGGCCATGAGCAAGGAAGAAAGTGAACCACGATTTCCACCACAGAATCAAGATAGCCAACCTGGAAAAGAATATCTCATGGA...

Protein

Download Protein FASTA

352 aa · LXL04_002847|LXL04_002847|OH1004|PROTEIN

MYSVSAPLMGSAFARVPFTQKSGNMLNFCPSTRISNNGVASMVTSVLRRGSSSIHTFKAKAMSKEESEPRFPPQNQDSQPGKEYLMDPLPIFSNPHYKPSNKLQGKVALVTGGDSGIGRAVCCSFAKEGATIAFTYVKGVEDIDAENTLKIINDSKTSDAGDPIAIPTDVRYDENCKKVVDQVVAKYGRIDVLVNNAAVQYETYSLDDITEQRLERLFKTNIFSQFFLTKYAVKHMKEGSNIINTTSAVGYTGSSKLLDY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002847`
TK1151 ID	TkA01G556120
OH-1004 ID	LXL04_002847
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.000
Protein coverage (%)	TK1151 47.395 / OH-1004 80.114 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_002847

Location Chr01:59624516-59629722 (+)

Description Similar to CAISE5: Glucose and ribitol dehydrogenase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05260`	May act as a short alcohol-polyol-sugar dehydrogenase possibly related to carbohydrate metabolism and the acquisition of desiccation tolerance.	No verified direct reference in this release
`At1g54870`	Aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons.	NADPH-dependent reductases involved in the detoxification of reactive carbonyls in plants.2011 · DOI: 10.1074/jbc.m110.202226

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0140800`	May act as a short alcohol-polyol-sugar dehydrogenase possibly related to carbohydrate metabolism and the acquisition of desiccation tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002847 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0008206 bile acid metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0008106 alcohol dehydrogenase (NADP+) activity Molecular Function

GO:0016614 oxidoreductase activity, acting on CH-OH group of donors Molecular Function

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

KEGG gene cross-reference

ath:AT1G54870

ath:AT3G05260

bsu:BSU09450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.975

Rank 1 · LXL04_002847 · OH-1004

Mitochondrion0.039

Rank 2 · LXL04_002847 · OH-1004

Cytoplasm0.016

Rank 3 · LXL04_002847 · OH-1004

Nucleus0.015

Rank 4 · LXL04_002847 · OH-1004

Peroxisome0.011

Rank 5 · LXL04_002847 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23441.1SDR100-305 aa

PF00106.32adh_short106-303 aa

PF08659.17KR108-292 aa

PF13561.13adh_short_C2114-349 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002847	`PF23441.1`	SDR	100	305	3.2e-07	30.7
LXL04_002847	`PF00106.32`	adh_short	106	303	3.1e-44	151.5
LXL04_002847	`PF08659.17`	KR	108	292	7.9e-08	33.1
LXL04_002847	`PF13561.13`	adh_short_C2	114	349	6.5e-54	183.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MA93`	Arabidopsis thaliana	Glucose and ribitol dehydrogenase homolog 2	64.311%	Swiss-Prot	strong database homology
`Q9FZ42`	Arabidopsis thaliana	NADPH-dependent aldehyde reductase 1, chloroplastic	65.343%	Swiss-Prot	strong database homology
`Q75KH3`	Oryza sativa subsp. japonica	Glucose and ribitol dehydrogenase homolog	59.386%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card