LXL04_000537 | RubberDandelionOmics

Gene overview

LXL04_000537

Reference: OH-1004 Chr: Chr01 Coordinates: 9987313-9990222 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1506 bp · LXL04_000537|LXL04_000537|OH1004|cDNA

CAAATTactttttttattgtttttcatcAACACAAATAACGGATAACGCACACGCGCTCTCTCCTTCTCCCCTCTCATCCGCACACACAAATGAGAAGGTGAGTGAATtgcagagagagagagagagagagcttcCGGCAATCCATCCATCCATCCATGGCCAAATCTCTTATTTCATCGCCTTCATCCTTCGTCGGAACACCTTTCCCCTCGCTCTATCGCCATGGACGCCTTTCTCCCAGGACTAAGCTTATATCCAC...

CDS

Download CDS FASTA

1350 bp · LXL04_000537|LXL04_000537|OH1004|CDS

ATGGCCAAATCTCTTATTTCATCGCCTTCATCCTTCGTCGGAACACCTTTCCCCTCGCTCTATCGCCATGGACGCCTTTCTCCCAGGACTAAGCTTATATCCACCAGAGTGAAGTTCAGCTTCAACGGACTTCCTCCAATTTCTTCATTAGATGGCGTCTCTATGGATTTATCTGCAATCGCCAGCCGTGCGGAGAGCCTTATGTATACTTTGGCTGATGCAGCGGTTGCTGTTGATTCCGCTGCTTCTGTTTCCGGGGA...

Protein

Download Protein FASTA

449 aa · LXL04_000537|LXL04_000537|OH1004|PROTEIN

MAKSLISSPSSFVGTPFPSLYRHGRLSPRTKLISTRVKFSFNGLPPISSLDGVSMDLSAIASRAESLMYTLADAAVAVDSAASVSGDSATTTVQKSGGWFGFISDAMEVVLKVLKDGLSAVHIPYSYGFAIILLTVLVKVATLPLTKQQVESTLAMQNLQPKLKAIQQRYAGNQERIQLETSRLYKQAGVNPLAGCLPTLATIPVWIGLYQALSNVANEGLFTEGFFWIPSLGGPTTIAARQSGSGVSWLFPFVDGHPPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000537`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000537

Location Chr01:9987313-9990222 (-)

Description Similar to PPF-1: Inner membrane protein PPF-1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28800`	Required for the insertion of some light harvesting chlorophyll-binding proteins (LHCP) into the chloroplast thylakoid membrane.	ALBINO3, an Arabidopsis nuclear gene essential for chloroplast differentiation, encodes a chloroplast protein that shows homology to proteins present in bacterial membranes and yeast mitochondria.1997 · DOI: 10.1105/tpc.9.5.717
`At1g24490`	Required for the insertion of some light harvesting chlorophyll-binding proteins (LHCP) into the chloroplast thylakoid membrane.	Alb4 of Arabidopsis promotes assembly and stabilization of a non chlorophyll-binding photosynthetic complex, the CF1CF0-ATP synthase.2009 · DOI: 10.1093/mp/ssp095 Genetic and Physical Interaction Studies Reveal Functional Similarities between ALBINO3 and ALBINO4 in Arabidopsis.2015 · DOI: 10.1104/pp.15.00376 Suppressors of the Chloroplast Protein Import Mutant <i>tic40</i> Reveal a Genetic Link between Protein Import and Thylakoid Biogenesis.2017 · DOI: 10.1105/tpc.16.00962

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000537 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009658 chloroplast organization Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0045038 protein import into chloroplast thylakoid membrane Biological Process

GO:0051205 protein insertion into membrane Biological Process

GO:0070208 protein heterotrimerization Biological Process

GO:0072598 protein localization to chloroplast Biological Process

GO:0005777 peroxisome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0032991 protein-containing complex Cellular Component

KEGG gene cross-reference

ath:AT1G24490

ath:AT2G28800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.983

Rank 1 · LXL04_000537 · OH-1004

Mitochondrion0.021

Rank 2 · LXL04_000537 · OH-1004

Nucleus0.017

Rank 3 · LXL04_000537 · OH-1004

Cytoplasm0.016

Rank 4 · LXL04_000537 · OH-1004

Peroxisome0.013

Rank 5 · LXL04_000537 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02096.2760KD_IMP126-341 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000537	`PF02096.27`	60KD_IMP	126	341	2.5e-58	197.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LBP4`	Arabidopsis thaliana	Inner membrane protein ALBINO3, chloroplastic	75.931%	Swiss-Prot	strong database homology
`Q9FYL3`	Arabidopsis thaliana	ALBINO3-like protein 1, chloroplastic	70.833%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card