LXL04_000517 | RubberDandelionOmics

Gene overview

LXL04_000517

Reference: OH-1004 Chr: Chr01 Coordinates: 9664286-9665260 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

645 bp · LXL04_000517|LXL04_000517|OH1004|cDNA

ATGTTCAACACAGAAGACACGCACGAACGTGAATACCTAAAACGATCCTACACAGAATCCATGGTGCACCGACCGTTCATCAGAAAAGCAATCAACAACATTTTCTACCAATTCATCTACGAAAACGAAAGAAACAGTGGAATCGCCGAGCTGTTAGAAATCCTCAGGAGTATAATCAATGGATTCGCATTACCAATGAAGGAAGAACACAAAATGTTTCTCGTTCATCTCCAGGTCTCTGATGGTCTCCGATGGCAGCA...

CDS

Download CDS FASTA

645 bp · LXL04_000517|LXL04_000517|OH1004|CDS

ATGTTCAACACAGAAGACACGCACGAACGTGAATACCTAAAACGATCCTACACAGAATCCATGGTGCACCGACCGTTCATCAGAAAAGCAATCAACAACATTTTCTACCAATTCATCTACGAAAACGAAAGAAACAGTGGAATCGCCGAGCTGTTAGAAATCCTCAGGAGTATAATCAATGGATTCGCATTACCAATGAAGGAAGAACACAAAATGTTTCTCGTTCATCTCCAGGTCTCTGATGGTCTCCGATGGCAGCA...

Protein

Download Protein FASTA

214 aa · LXL04_000517|LXL04_000517|OH1004|PROTEIN

MFNTEDTHEREYLKRSYTESMVHRPFIRKAINNIFYQFIYENERNSGIAELLEILRSIINGFALPMKEEHKMFLVHLQVSDGLRWQHRWSPFISSPPQSQQQEDDDEEKECWCGCRSFVFFPNSKQDETGMEEGVLPQFVVADPSCSSPIHLHCYPLNPEFLGFESIELLRRSGQKGRSPSEIVKNSETNEKVKNPNASVVGLVLQRSHIVRES

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000517`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000517

Location Chr01:9664286-9665260 (+)

Description Similar to B'BETA: Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' beta isoform

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09880`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	No verified direct reference in this release
`At5g03470`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	No verified direct reference in this release
`At4g15415`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	Regulatory subunit B'gamma of protein phosphatase 2A prevents unnecessary defense reactions under low light in Arabidopsis.2011 · DOI: 10.1104/pp.111.178442
`At3g21650`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	No verified direct reference in this release
`At1g13460`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000517 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006555 methionine metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009554 megasporogenesis Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009759 indole glucosinolate biosynthetic process Biological Process

GO:0009908 flower development Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010150 leaf senescence Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0032000 positive regulation of fatty acid beta-oxidation Biological Process

GO:0033353 S-adenosylmethionine cycle Biological Process

KEGG gene cross-reference

ath:AT1G13460

ath:AT3G09880

ath:AT3G21650

ath:AT4G15415

ath:AT5G03470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.458

Rank 1 · LXL04_000517 · OH-1004

Cytoplasm0.415

Rank 2 · LXL04_000517 · OH-1004

Mitochondrion0.116

Rank 3 · LXL04_000517 · OH-1004

Cell membrane0.097

Rank 4 · LXL04_000517 · OH-1004

Endoplasmic reticulum0.066

Rank 5 · LXL04_000517 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01603.27B561-76 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000517	`PF01603.27`	B56	1	76	1.9e-25	90.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04376`	Arabidopsis thaliana	Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' beta isoform	71.084%	Swiss-Prot	weak database homology
`O04375`	Arabidopsis thaliana	Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' alpha isoform	73.418%	Swiss-Prot	weak database homology
`Q8RW96`	Arabidopsis thaliana	Serine/threonine protein phosphatase 2A 59 kDa regulatory subunit B' gamma isoform	70.886%	Swiss-Prot	weak database homology
`Q9LVE2`	Arabidopsis thaliana	Serine/threonine protein phosphatase 2A 59 kDa regulatory subunit B' zeta isoform	69.620%	Swiss-Prot	weak database homology
`Q8LF36`	Arabidopsis thaliana	Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' theta isoform	62.651%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card