TkAUNG096530 | RubberDandelionOmics

Gene overview

TkAUNG096530

Reference: TK1151 Chr: ChrUn Coordinates: 27296091-27303754 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1855 bp · TkAUNG096530|TK1151|cDNA

CCACTTCCCACTTCCCACCTCGCGTCACACCGTAAGGCGTAAGTCGGTTTTTTTGCAGACAAATCCCACCTCCTGTCCTGAAACTGAAGCTTCCCGATGCTTTTCGTAGCCATCAATGGCCGCCAGTAAACACATGAGACGCTTGTTGCATAATATAGATTTAAAGTCCAATTTGTTAAAGGAAAGGGAACCTTACAATCCATACGTATATAATGTCCTCAACCGCTATCAATCACAATGGTCAAAAGTTTCAGATCCAA...

CDS

Download CDS FASTA

1656 bp · TkAUNG096530|TK1151|CDS

ATGGCCGCCAGTAAACACATGAGACGCTTGTTGCATAATATAGATTTAAAGTCCAATTTGTTAAAGGAAAGGGAACCTTACAATCCATACGTATATAATGTCCTCAACCGCTATCAATCACAATGGTCAAAAGTTTCAGATCCAAACAAAAAAGATGCAAAAGACGATCCATCTGTACCACCCAAAATACCTCAAAATATCAACCAAACAGACTCAGCCTCTATGGCTAACAAATACAGTTCAGATGAAGAGGATTCAAC...

Protein

Download Protein FASTA

551 aa · TkAUNG096530|TK1151|PROTEIN

MAASKHMRRLLHNIDLKSNLLKEREPYNPYVYNVLNRYQSQWSKVSDPNKKDAKDDPSVPPKIPQNINQTDSASMANKYSSDEEDSTTNKWKLELAWLTKALEPALQLCKWPLPTGNTHTTKIPPSTRTLAEILASIQRSKLGVQDWSLSDLTIGLYLIYLQQASTNPFQDVKGTKITSDTVIQDLIYHIELAKGAYRDSAGGLAKNSMLRESNIIKFVKNSSMLRPGYYIGVDVRNKLVIFGIRGTHTVYDLITDIVSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG096530`
TK1151 ID	TkAUNG096530
OH-1004 ID	LXL04_000957
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	95.300
Protein coverage (%)	TK1151 100.000 / OH-1004 87.175 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG096530`
Location	ChrUn:27296091-27303754 (+)
Description	Similar to Daglb: Diacylglycerol lipase-beta
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_000957` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006690 icosanoid metabolic process Biological Process GO:0010898 positive regulation of triglyceride catabolic process Biological Process GO:0019369 arachidonate metabolic process Biological Process GO:0045471 response to ethanol Biological Process GO:0046340 diacylglycerol catabolic process Biological Process GO:1901696 cannabinoid biosynthetic process Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005886 plasma membrane Cellular Component GO:0004806 triacylglycerol lipase activity Molecular Function GO:0016298 lipase activity Molecular Function GO:0046872 metal ion binding Molecular Function GO:0047372 monoacylglycerol lipase activity Molecular Function
KEGG gene cross-reference	mmu:231871 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.598

Rank 1 · TkAUNG096530 · TK1151

Plastid0.298

Rank 2 · TkAUNG096530 · TK1151

Cytoplasm0.098

Rank 3 · TkAUNG096530 · TK1151

Nucleus0.048

Rank 4 · TkAUNG096530 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkAUNG096530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00561Abhydrolase_157-137 aa

PF01764Lipase_3242-375 aa

PF24708Lip_C269-333 aa

PF07859Abhydrolase_3278-327 aa

PF12146Hydrolase_4291-324 aa

PF26363Phospholipase-like292-322 aa

PF05057DUF676297-326 aa

PF00561Abhydrolase_1303-320 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG096530	`PF00561`	Abhydrolase_1	57	137	0.072	13.5
TkAUNG096530	`PF01764`	Lipase_3	242	375	4.8e-27	95.3
TkAUNG096530	`PF24708`	Lip_C	269	333	0.038	13.4
TkAUNG096530	`PF07859`	Abhydrolase_3	278	327	0.043	14.3
TkAUNG096530	`PF12146`	Hydrolase_4	291	324	0.15	12.1
TkAUNG096530	`PF26363`	Phospholipase-like	292	322	0.0091	16.0
TkAUNG096530	`PF05057`	DUF676	297	326	0.21	11.8
TkAUNG096530	`PF00561`	Abhydrolase_1	303	320	0.072	13.5
TkAUNG096530	`PF12697`	Abhydrolase_6	305	324	0.22	12.8
TkAUNG096530	`PF07859`	Abhydrolase_3	489	527	0.043	14.3
TkAUNG096530	`PF05057`	DUF676	510	525	0.21	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card