TkAUNG096060 | RubberDandelionOmics

Gene overview

TkAUNG096060

Reference: TK1151 Chr: ChrUn Coordinates: 27166941-27169049 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1120 bp · TkAUNG096060|TK1151|cDNA

ATTCGTTCAGAAGCTGTATCCGGCGTCCGGCGGTATAAACAGTCGAGGATCCGTCTCGCCTAAATCCATCGACTGAGAAGGAAAAGTCCATAAATTTATTTGAAGAGTGAAAAAACTCAGGCTGCCATGGCTACACTTCCCTTTGGAGATGACAAACGCCCGATTACAACGGTTCTCATTTTTGCTGCCATGGATTCAGAAGCGCTTCCGATTGTCGAACACTTTAAACTTTCACGGGATGATGGTTCTTTGTTTCCATT...

CDS

Download CDS FASTA

765 bp · TkAUNG096060|TK1151|CDS

ATGGCTACACTTCCCTTTGGAGATGACAAACGCCCGATTACAACGGTTCTCATTTTTGCTGCCATGGATTCAGAAGCGCTTCCGATTGTCGAACACTTTAAACTTTCACGGGATGATGGTTCTTTGTTTCCATTAAGTGTCCCTTGGATCAGATATCATGGTAGCTACAAGGATCTTAATATAAATGTCATTTATCCTGGGAAGGACCCCGAATTTGGTATCAATAGTGTAGGTACAGTTCCTGCATCTCTTGTGACTTA...

Protein

Download Protein FASTA

254 aa · TkAUNG096060|TK1151|PROTEIN

MATLPFGDDKRPITTVLIFAAMDSEALPIVEHFKLSRDDGSLFPLSVPWIRYHGSYKDLNINVIYPGKDPEFGINSVGTVPASLVTYASIQALKPDLVINAGTAGAFKVKGACIFDVYLVSDLAFHDRRIPIPGPDRYGVGLRKSFPTPNLVRELSLKVCKLSTGDSLDMCPQDETCILANDATIVDMEGAALAYVCSLMKVPVIFIKGVSNFVDGEKSIPEEFKENLQTTVVAIRKVVAQVVEFINGKCLSEL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG096060`
TK1151 ID	TkAUNG096060
OH-1004 ID	LXL04_032962
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG096060

Location ChrUn:27166941-27169049 (-)

Description Similar to MTN2: 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34840`	Enzyme of the methionine cycle that catalyzes the irreversible cleavage of the glycosidic bond in 5'-methylthioadenosine (MTA) and S-adenosylhomocysteine (SAH/AdoHcy) to a lesser extent, to adenine and the corresponding thioribose, 5'-methylthioribose and S- ribosylhomocysteine, respectively.	The role of methionine recycling for ethylene synthesis in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2006.02942.x Molecular determinants of substrate specificity in plant 5'-methylthioadenosine nucleosidases.2008 · DOI: 10.1016/j.jmb.2008.01.088 Biochemical and structural characterization of 5'-methylthioadenosine nucleosidases from Arabidopsis thaliana.2009 · DOI: 10.1016/j.bbrc.2009.02.106 Inhibition of 5'-methylthioadenosine metabolism in the Yang cycle alters polyamine levels, and impairs seedling growth and reproduction in Arabidopsis.2010 · DOI: 10.1111/j.1365-313x.2010.04211.x Mechanism of substrate specificity in 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidases.2011 · DOI: 10.1016/j.jsb.2010.06.006
`At4g38800`	Enzyme of the methionine cycle that catalyzes the irreversible cleavage of the glycosidic bond in 5'-methylthioadenosine (MTA) to adenine and 5'-methylthioribose.	The role of methionine recycling for ethylene synthesis in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2006.02942.x Molecular determinants of substrate specificity in plant 5'-methylthioadenosine nucleosidases.2008 · DOI: 10.1016/j.jmb.2008.01.088 Biochemical and structural characterization of 5'-methylthioadenosine nucleosidases from Arabidopsis thaliana.2009 · DOI: 10.1016/j.bbrc.2009.02.106 Inhibition of 5'-methylthioadenosine metabolism in the Yang cycle alters polyamine levels, and impairs seedling growth and reproduction in Arabidopsis.2010 · DOI: 10.1111/j.1365-313x.2010.04211.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032962 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009116 nucleoside metabolic process Biological Process

GO:0009164 nucleoside catabolic process Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0019284 L-methionine salvage from S-adenosylmethionine Biological Process

GO:0019509 L-methionine salvage from methylthioadenosine Biological Process

GO:0046124 purine deoxyribonucleoside catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008782 adenosylhomocysteine nucleosidase activity Molecular Function

GO:0008930 methylthioadenosine nucleosidase activity Molecular Function

KEGG gene cross-reference

ath:AT4G34840

ath:AT4G38800

bas:BUsg_204

hip:CGSHiEE_05950

ppr:PBPRA0538

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.700

Rank 1 · TkAUNG096060 · TK1151

Nucleus0.322

Rank 2 · TkAUNG096060 · TK1151

Mitochondrion0.074

Rank 3 · TkAUNG096060 · TK1151

Peroxisome0.061

Rank 4 · TkAUNG096060 · TK1151

Endoplasmic reticulum0.061

Rank 5 · TkAUNG096060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01048PNP_UDP_116-243 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG096060	`PF01048`	PNP_UDP_1	16	243	7.4e-25	88.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7XA67`	Arabidopsis thaliana	sp\|Q7XA67\|MTN2_ARATH 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	58.900%	Swiss-Prot	High
`Q9T0I8`	Arabidopsis thaliana	sp\|Q9T0I8\|MTN1_ARATH 5'-methylthioadenosine nucleosidase	60.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card