TkAUNG091990 | RubberDandelionOmics

Gene overview

TkAUNG091990

Reference: TK1151 Chr: ChrUn Coordinates: 26051830-26054686 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1534 bp · TkAUNG091990|TK1151|cDNA

ATGAAACCCAGAAAGGGAACGATTGTGAACCATGCTATGTACGCCTACTTTGATAGGGATAATGCCGCTCTCAAGGGCTTAGCCAAGTTCTTTAAGGAATCCAGTGAGGAGGAAAGGGAACATGCTGAGATGTTTATGGAGTACCAGGTTCAAGTCAGATCAAGAGAGGCACCGGTTCATGATATTGGTGAGGAAACATTTCCTAATTTGCTCAATATATTTAGCAGGCTTGTACAGATAGGAAATCCATCAAAAGAAGT...

CDS

Download CDS FASTA

462 bp · TkAUNG091990|TK1151|CDS

ATGAAACCCAGAAAGGGAACGATTGTGAACCATGCTATGTACGCCTACTTTGATAGGGATAATGCCGCTCTCAAGGGCTTAGCCAAGTTCTTTAAGGAATCCAGTGAGGAGGAAAGGGAACATGCTGAGATGTTTATGGAGTACCAGGTTCAAGTCAGATCAAGAGAGGCACCGGTTCATGATATTGGTGAGGAAACATTTCCTAATTTGCTCAATATATTTAGCAGGCTTGTACAGATAGGAAATCCATCAAAAGAAGT...

Protein

Download Protein FASTA

153 aa · TkAUNG091990|TK1151|PROTEIN

MKPRKGTIVNHAMYAYFDRDNAALKGLAKFFKESSEEEREHAEMFMEYQVQVRSREAPVHDIGEETFPNLLNIFSRLVQIGNPSKEVADLINLICKIYWYSICPEISKKLVDPNRLEIPVPLEGQPTDPHLPKSLGWWKVKKWAVHILNRLYT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG091990`
TK1151 ID	TkAUNG091990
OH-1004 ID	LXL04_006252
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	82.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG091990

Location ChrUn:26051830-26054686 (+)

Description Similar to At3g59020: Importin beta-like SAD2 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59020`	Functions probably in nuclear protein import, either by acting as autonomous nuclear transport receptor or as an adapter-like protein in association with other importin subunits.	No verified direct reference in this release
`At2g31660`	Functions probably in nuclear protein import, either by acting as autonomous nuclear transport receptor or as an adapter-like protein in association with other importin subunits (Probable).	Mutation of SAD2, an importin beta-domain protein in Arabidopsis, alters abscisic acid sensitivity.2006 · DOI: 10.1111/j.1365-313x.2006.02833.x SAD2, an importin -like protein, is required for UV-B response in Arabidopsis by mediating MYB4 nuclear trafficking.2007 · DOI: 10.1105/tpc.106.048900 SAD2 in Arabidopsis functions in trichome initiation through mediating GL3 function and regulating GL1, TTG1 and GL2 expression.2008 · DOI: 10.1111/j.1744-7909.2008.00695.x Jasmonic acid control of GLABRA3 links inducible defense and trichome patterning in Arabidopsis.2009 · DOI: 10.1242/dev.030585 An importin β protein negatively regulates MicroRNA activity in Arabidopsis.2011 · DOI: 10.1105/tpc.111.091058
`At5g01600`	Stores iron in a soluble, non-toxic, readily available form.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006252 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006606 protein import into nucleus Biological Process

GO:0006826 iron ion transport Biological Process

GO:0006879 intracellular iron ion homeostasis Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004322 ferroxidase activity Molecular Function

GO:0008198 ferrous iron binding Molecular Function

GO:0008199 ferric iron binding Molecular Function

KEGG gene cross-reference

ath:AT2G31660

ath:AT3G59020

bna:106433816

gmx:547476

gmx:547477

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.415

Rank 1 · TkAUNG091990 · TK1151

Nucleus0.244

Rank 2 · TkAUNG091990 · TK1151

Mitochondrion0.207

Rank 3 · TkAUNG091990 · TK1151

Peroxisome0.098

Rank 4 · TkAUNG091990 · TK1151

Extracellular0.092

Rank 5 · TkAUNG091990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00210Ferritin11-54 aa

PF02915Rubrerythrin12-68 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG091990	`PF00210`	Ferritin	11	54	1.3e-08	35.7
TkAUNG091990	`PF02915`	Rubrerythrin	12	68	0.00092	20.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J738`	Arabidopsis thaliana	sp\|F4J738\|SAD2H_ARATH Importin beta-like SAD2 homolog	55.600%	Swiss-Prot	Medium
`F4IRR2`	Arabidopsis thaliana	sp\|F4IRR2\|SAD2_ARATH Importin beta-like SAD2	53.800%	Swiss-Prot	Medium
`Q39101`	Arabidopsis thaliana	sp\|Q39101\|FRI1_ARATH Ferritin-1, chloroplastic	78.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card