TkAUNG088830 | RubberDandelionOmics

Gene overview

TkAUNG088830

Reference: TK1151 Chr: ChrUn Coordinates: 25212252-25213368 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

927 bp · TkAUNG088830|TK1151|cDNA

ATGCATGGTGTTCTTCGACTTATTGTTACTCTAGATGGTGAAGATGTTATTGACTGTGAACCCATATTGGGTTATTTACACAGAGAAGCAATAACTGTAAATGCACCAGAGCAATTAGGCAATATTCAAGTCCCTAAAAGGGCCAGTTATATCAGAGTCATTATGTTAGAGTTAAGTCGTATAGCTTCGCATTTGTTATGGCTTGGCCCTTTTATGGCAGATATTGGGGCGCAGACTCCTTTCTTCTATATTTTTCGAGA...

CDS

Download CDS FASTA

927 bp · TkAUNG088830|TK1151|CDS

ATGCATGGTGTTCTTCGACTTATTGTTACTCTAGATGGTGAAGATGTTATTGACTGTGAACCCATATTGGGTTATTTACACAGAGAAGCAATAACTGTAAATGCACCAGAGCAATTAGGCAATATTCAAGTCCCTAAAAGGGCCAGTTATATCAGAGTCATTATGTTAGAGTTAAGTCGTATAGCTTCGCATTTGTTATGGCTTGGCCCTTTTATGGCAGATATTGGGGCGCAGACTCCTTTCTTCTATATTTTTCGAGA...

Protein

Download Protein FASTA

308 aa · TkAUNG088830|TK1151|PROTEIN

MHGVLRLIVTLDGEDVIDCEPILGYLHREAITVNAPEQLGNIQVPKRASYIRVIMLELSRIASHLLWLGPFMADIGAQTPFFYIFRERELIYDLFEAATGIAEYQKLIMRNPIFLQRVEGVGIIGGEEAINWGLSGPMLRASGIQWDLRKVDHYECYDEFDWEVQWQKEGDSLARYLVRINEMTESIKIIQQALEGIPGGPYENLETRRFARVKDTLWNEFDYRFISKKPSPTFELSKQELYARVEAPKGELGIFLIGDK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG088830`
TK1151 ID	TkAUNG088830
OH-1004 ID	LXL04_040109
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	32.200
Protein coverage (%)	TK1151 35.065 / OH-1004 71.144 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG088830`
Location	ChrUn:25212252-25213368 (+)
Description	Similar to NAD7: NADH dehydrogenase [ubiquinone] iron-sulfur protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_040109` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006120 mitochondrial electron transport, NADH to ubiquinone Biological Process GO:0005739 mitochondrion Cellular Component GO:0005743 mitochondrial inner membrane Cellular Component GO:0009536 plastid Cellular Component GO:0045271 respiratory chain complex I Cellular Component GO:0008137 NADH dehydrogenase (ubiquinone) activity Molecular Function GO:0016651 oxidoreductase activity, acting on NAD(P)H Molecular Function GO:0046872 metal ion binding Molecular Function GO:0048038 quinone binding Molecular Function GO:0051287 NAD binding Molecular Function GO:0051539 4 iron, 4 sulfur cluster binding Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.746

Rank 1 · TkAUNG088830 · TK1151

Nucleus0.210

Rank 2 · TkAUNG088830 · TK1151

Peroxisome0.084

Rank 3 · TkAUNG088830 · TK1151

Mitochondrion0.076

Rank 4 · TkAUNG088830 · TK1151

Endoplasmic reticulum0.039

Rank 5 · TkAUNG088830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00346Complex1_49kDa74-100 aa

PF00346Complex1_49kDa101-308 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG088830	`PF00346`	Complex1_49kDa	74	100	1.7e-80	270.7
TkAUNG088830	`PF00346`	Complex1_49kDa	101	308	1.7e-80	270.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card