Gene Card
Gene overview
cDNA / CDS / Protein Sequences
375 bp · TkAUNG082110|TK1151|cDNA
GGTTTTTATTACAAATTTGGTCCGACGCCGGGAAAAAAACGGAAACAGCGAAGCTACTACACAGGGAAGGGTGCGAACTTACCGGAGGGTGATTGCCGATCGACGGCAGCGCCGATTCGCGGAGGTCCTCGCTGCGCCGGTGGTCGCAGCGCCCGTCTTCCGCCGTTCTCCCTTCTGCCTCACTCGCCGGCTCCGTCCAGGTGTGTTCGTCCCCCCTCCCGACGCGTTTCTCTCTCTGTGCCTCGAAATGGTGCTCGATT...
375 bp · TkAUNG082110|TK1151|CDS
GGTTTTTATTACAAATTTGGTCCGACGCCGGGAAAAAAACGGAAACAGCGAAGCTACTACACAGGGAAGGGTGCGAACTTACCGGAGGGTGATTGCCGATCGACGGCAGCGCCGATTCGCGGAGGTCCTCGCTGCGCCGGTGGTCGCAGCGCCCGTCTTCCGCCGTTCTCCCTTCTGCCTCACTCGCCGGCTCCGTCCAGGTGTGTTCGTCCCCCCTCCCGACGCGTTTCTCTCTCTGTGCCTCGAAATGGTGCTCGATT...
Protein
Download Protein FASTA124 aa · TkAUNG082110|TK1151|PROTEIN
GFYYKFGPTPGKKRKQRSYYTGKGANLPEGDCRSTAAPIRGGPRCAGGRSARLPPFSLLPHSPAPSRCVRPPSRRVSLSVPRNGARLVPDALLKLPGEDEREGGTRPLPFPDAHRPQTVGMNRF
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG082110 |
|---|---|
| TK1151 ID | TkAUNG082110 |
| OH-1004 ID | LXL04_002355 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 54.200 |
| Protein coverage (%) | TK1151 45.161 / OH-1004 11.175Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG082110 |
|---|---|
| Location | ChrUn:23383031-23383441 (+) |
| Description | Similar to BRXL4: Protein Brevis radix-like 4 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0009734 auxin-activated signaling pathway Biological Process GO:0009736 cytokinin-activated signaling pathway Biological Process GO:0009737 response to abscisic acid Biological Process GO:0010078 maintenance of root meristem identity Biological Process GO:0010088 phloem development Biological Process GO:0010315 auxin export across the plasma membrane Biological Process GO:0010440 stomatal lineage progression Biological Process GO:0030154 cell differentiation Biological Process GO:0048364 root development Biological Process GO:0048527 lateral root development Biological Process GO:0048756 sieve cell differentiation Biological Process GO:2000280 regulation of root development Biological Process |
| KEGG gene cross-reference | ath:AT1G31880 ath:AT1G54180 ath:AT3G14000 ath:AT5G20540 dosa:Os08g0462700 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.