TkAUNG066550 | RubberDandelionOmics

Gene overview

TkAUNG066550

Reference: TK1151 Chr: ChrUn Coordinates: 19331515-19334455 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1476 bp · TkAUNG066550|TK1151|cDNA

AAAACATCGAGTACATTAGGTTTTCCGTAGGCCTACTATTTATTTGGGCTATAAACAATGCTAAATTATGTGTCATAAGCTGGTAAGGCGTACGCCTTAAGGCTCCCAACTCCCAGGTCCCCAACCATTATGATATTTTCCGGCACGGCGCCGTTTTGTGGTTCGGTTTTAATCGGTGGAAACGTGCTTCAAATTTCTAAATCAACCAAAGATTTCCATCCATTCAATTCATATACCATCTCTGTACCTTCTACACACAT...

CDS

Download CDS FASTA

786 bp · TkAUNG066550|TK1151|CDS

ATGGCGAGGAGAGAGACAAATTGCAGATCATCATCGATCAGAAGGAGGAGAAGGAAGATAAACACGGTAAGTATCAACGGCAAAGGTAAATTAACAAAACGGCGACGATCGCAGCGGCGGCCTGTGGTCAGATCTCTTCCTAGCGATCTCTTGGTCGATGTACTTTCTCGCGTTGCATCCTCTTCCTTCACAGATCTCTTCAATGCTAAATTATGTTGTCGGGATTTTCTCGGAGCAGCAGAAGACGAGTCCATCTTTCA...

Protein

Download Protein FASTA

261 aa · TkAUNG066550|TK1151|PROTEIN

MARRETNCRSSSIRRRRRKINTVSINGKGKLTKRRRSQRRPVVRSLPSDLLVDVLSRVASSSFTDLFNAKLCCRDFLGAAEDESIFQHVSIDKFPVIHWFPPSDELLLFLNRCIDKGNPESMFRQGMIEFFSLARIETGLEYLKRATEKGHVEATYVYGMILLSRGGQSSQQGLNILNSMKVSRSNYLKIRECRAKIKAIIRVMWINNSISLNEVGCKCQGRNNVCIRKRKFEEEEEVIGCDACGWYREVISFCKIVDGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG066550`
TK1151 ID	TkAUNG066550
OH-1004 ID	LXL04_020683
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG066550`
Location	ChrUn:19331515-19334455 (-)
Description	Similar to At1g67623: Putative F-box protein At1g67623
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020683` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016567 protein ubiquitination Biological Process GO:0005634 nucleus Cellular Component GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	ath:AT1G67340 ath:AT1G67623 ath:AT2G35280 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.846

Rank 1 · TkAUNG066550 · TK1151

Cytoplasm0.136

Rank 2 · TkAUNG066550 · TK1151

Plastid0.037

Rank 3 · TkAUNG066550 · TK1151

Cell membrane0.027

Rank 4 · TkAUNG066550 · TK1151

Mitochondrion0.026

Rank 5 · TkAUNG066550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937F-box-like44-91 aa

PF00646F-box45-81 aa

PF23310TPR_2793-202 aa

PF00646F-box176-191 aa

PF05207Zn_ribbon_CSL216-245 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG066550	`PF12937`	F-box-like	44	91	3.8e-05	24.1
TkAUNG066550	`PF00646`	F-box	45	81	0.28	11.9
TkAUNG066550	`PF23310`	TPR_27	93	202	7.3e-38	129.3
TkAUNG066550	`PF00646`	F-box	176	191	0.28	11.9
TkAUNG066550	`PF05207`	Zn_ribbon_CSL	216	245	0.0065	16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card