TkAUNG053720 | RubberDandelionOmics

Gene overview

TkAUNG053720

Reference: TK1151 Chr: ChrUn Coordinates: 15359716-15363887 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

636 bp · TkAUNG053720|TK1151|cDNA

ATGTTCCTTTGGGAAGCTTGGCAAGATTTGACACTTATTATCTTGATAGTAGCTGCTGCTGCATCACTGGTTCTAGGAATCAAAACAGAGGAAAGTTTCAAAGTTCCTGCTGATGATCTTCTAATAAAGGGTCACTCTCTAGCCATTGATGAATCTAGCATGACGGGAGAAAGCAAGATTGCACACAAGGATCAAAAATCACCTTTTTTAATGTATGGATGCAAAGTAGCAGATGGTGCAGGAACCATGATGGTAACTGG...

CDS

Download CDS FASTA

636 bp · TkAUNG053720|TK1151|CDS

ATGTTCCTTTGGGAAGCTTGGCAAGATTTGACACTTATTATCTTGATAGTAGCTGCTGCTGCATCACTGGTTCTAGGAATCAAAACAGAGGAAAGTTTCAAAGTTCCTGCTGATGATCTTCTAATAAAGGGTCACTCTCTAGCCATTGATGAATCTAGCATGACGGGAGAAAGCAAGATTGCACACAAGGATCAAAAATCACCTTTTTTAATGTATGGATGCAAAGTAGCAGATGGTGCAGGAACCATGATGGTAACTGG...

Protein

Download Protein FASTA

211 aa · TkAUNG053720|TK1151|PROTEIN

MFLWEAWQDLTLIILIVAAAASLVLGIKTEESFKVPADDLLIKGHSLAIDESSMTGESKIAHKDQKSPFLMYGCKVADGAGTMMVTGVGINTEWGLLMASISDTGEETPLQVWLNGVATFIDIVSFIELCQKLDLLVMLRAGPYICAEWDFGGFPAWLLTKEPSIRLRSSDPVYLTLVDKWWGTLLPKIALLLYHKGGPIVMLQMGRFIEL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG053720`
TK1151 ID	TkAUNG053720
OH-1004 ID	LXL04_013849
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 80.569 / OH-1004 43.147 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG053720

Location ChrUn:15359716-15363887 (+)

Description Similar to BGAL17: Beta-galactosidase 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g21180`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles.	No verified direct reference in this release
`At4g29900`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the endoplasmic reticulum.	No verified direct reference in this release
`At5g57110`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell.	No verified direct reference in this release
`At1g72990`	Beta-galactosidase 17.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0605500`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013849 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0019388 galactose catabolic process Biological Process

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004565 beta-galactosidase activity Molecular Function

GO:0005388 P-type calcium transporter activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G72990

ath:AT3G21180

dosa:Os05g0539400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.344

Rank 1 · TkAUNG053720 · TK1151

Cell membrane0.153

Rank 2 · TkAUNG053720 · TK1151

Golgi apparatus0.152

Rank 3 · TkAUNG053720 · TK1151

Cytoplasm0.111

Rank 4 · TkAUNG053720 · TK1151

Lysosome / Vacuole0.089

Rank 5 · TkAUNG053720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00690Cation_ATPase_N2-22 aa

PF00122E1-E2_ATPase31-100 aa

PF14252DUF434765-108 aa

PF01301Glyco_hydro_35121-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG053720	`PF00690`	Cation_ATPase_N	2	22	0.24	11.8
TkAUNG053720	`PF00122`	E1-E2_ATPase	31	100	1.6e-09	38.2
TkAUNG053720	`PF14252`	DUF4347	65	108	0.078	13.5
TkAUNG053720	`PF01301`	Glyco_hydro_35	121	205	1.8e-31	110.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU41`	Arabidopsis thaliana	sp\|Q9LU41\|ACA9_ARATH Calcium-transporting ATPase 9, plasma membrane-type	51.600%	Swiss-Prot	Medium
`Q9SZR1`	Arabidopsis thaliana	sp\|Q9SZR1\|ACA10_ARATH Calcium-transporting ATPase 10, plasma membrane-type	47.600%	Swiss-Prot	Medium
`Q9LF79`	Arabidopsis thaliana	sp\|Q9LF79\|ACA8_ARATH Calcium-transporting ATPase 8, plasma membrane-type	44.600%	Swiss-Prot	Medium
`Q93Z24`	Arabidopsis thaliana	sp\|Q93Z24\|BGA17_ARATH Beta-galactosidase 17	59.600%	Swiss-Prot	Low
`Q7X8B5`	Oryza sativa subsp. japonica	sp\|Q7X8B5\|ACA5_ORYSJ Calcium-transporting ATPase 5, plasma membrane-type	49.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card