TkAUNG048340 | RubberDandelionOmics

Gene overview

TkAUNG048340

Reference: TK1151 Chr: ChrUn Coordinates: 13407862-13408515 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

516 bp · TkAUNG048340|TK1151|cDNA

ATGGGCAGGAAGAACAAGATTGCAGAGGATTATGTCAAGGGTGCTACAATTGGGAAAGGCAAGTTTGGATCAGTTTGGCTGTGTAGGTGCAGGGTTAGTGGTGTGGAGTTTTCATGCAGAACATTAGTGAAAGGTGAGGAGACAGTTCATAGGGAGGTTGAGATAATGCAGCATTTGTCAGGGCATCCAGGAGTTGTGACATTGAAGGCAGTCTATGAGGATTCAGAATCTTTTCATCTGGTGATGGAGTTGTGTTCAGG...

CDS

Download CDS FASTA

516 bp · TkAUNG048340|TK1151|CDS

ATGGGCAGGAAGAACAAGATTGCAGAGGATTATGTCAAGGGTGCTACAATTGGGAAAGGCAAGTTTGGATCAGTTTGGCTGTGTAGGTGCAGGGTTAGTGGTGTGGAGTTTTCATGCAGAACATTAGTGAAAGGTGAGGAGACAGTTCATAGGGAGGTTGAGATAATGCAGCATTTGTCAGGGCATCCAGGAGTTGTGACATTGAAGGCAGTCTATGAGGATTCAGAATCTTTTCATCTGGTGATGGAGTTGTGTTCAGG...

Protein

Download Protein FASTA

171 aa · TkAUNG048340|TK1151|PROTEIN

MGRKNKIAEDYVKGATIGKGKFGSVWLCRCRVSGVEFSCRTLVKGEETVHREVEIMQHLSGHPGVVTLKAVYEDSESFHLVMELCSGGRLIDQMTKEGRYSEQRAANIFKELMMVIKYCHDMGVVHRDVKPENILLTTSGKIKLADFGLAVRSLVVVCVYTLMMKLLTYIT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG048340`
TK1151 ID	TkAUNG048340
OH-1004 ID	LXL04_002878
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 88.889 / OH-1004 44.838 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG048340

Location ChrUn:13407862-13408515 (-)

Description Similar to PEPKR2: Serine/threonine-protein kinase PEPKR2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12680`	Serine/threonine-protein kinase PEPKR2.	No verified direct reference in this release
`At4g23650`	May play a role in signal transduction pathways that involve calcium as a second messenger.	CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca(2+)-permeable channels and stomatal closure.2006 · DOI: 10.1371/journal.pbio.0040327

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0491900`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002878 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0009931 calcium-dependent protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G12680

ath:AT1G76040

dosa:Os03g0788500

gmx:547825

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.580

Rank 1 · TkAUNG048340 · TK1151

Nucleus0.477

Rank 2 · TkAUNG048340 · TK1151

Mitochondrion0.072

Rank 3 · TkAUNG048340 · TK1151

Cell membrane0.067

Rank 4 · TkAUNG048340 · TK1151

Endoplasmic reticulum0.057

Rank 5 · TkAUNG048340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14531Kinase-like8-57 aa

PF00069Pkinase11-151 aa

PF07714PK_Tyr_Ser-Thr15-151 aa

PF06293Kdo45-148 aa

PF01636APH46-89 aa

PF01163RIO147-151 aa

PF03109ABC171-151 aa

PF12330Haspin_kinase74-150 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG048340	`PF14531`	Kinase-like	8	57	0.00068	19.7
TkAUNG048340	`PF00069`	Pkinase	11	151	2.3e-39	136.1
TkAUNG048340	`PF07714`	PK_Tyr_Ser-Thr	15	151	8.7e-23	81.6
TkAUNG048340	`PF06293`	Kdo	45	148	2.6e-05	24.5
TkAUNG048340	`PF01636`	APH	46	89	0.00011	22.8
TkAUNG048340	`PF01163`	RIO1	47	151	0.00014	22.2
TkAUNG048340	`PF03109`	ABC1	71	151	7.1e-07	29.3
TkAUNG048340	`PF12330`	Haspin_kinase	74	150	0.018	14.8
TkAUNG048340	`PF13095`	FTA2	98	150	0.15	12.5
TkAUNG048340	`PF10707`	YrbL-PhoP_reg	103	141	0.11	12.9
TkAUNG048340	`PF14531`	Kinase-like	111	152	0.00068	19.7
TkAUNG048340	`PF01636`	APH	122	151	0.00011	22.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W490`	Arabidopsis thaliana	sp\|Q8W490\|PEPK2_ARATH Serine/threonine-protein kinase PEPKR2	79.500%	Swiss-Prot	High
`Q42479`	Arabidopsis thaliana	sp\|Q42479\|CDPK3_ARATH Calcium-dependent protein kinase 3	42.300%	Swiss-Prot	Medium
`B9FKW9`	Oryza sativa subsp. japonica	sp\|B9FKW9\|CDPKE_ORYSJ Calcium-dependent protein kinase 14	45.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card