TkAUNG046690 | RubberDandelionOmics

Gene overview

TkAUNG046690

Reference: TK1151 Chr: ChrUn Coordinates: 12902759-12904021 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

507 bp · TkAUNG046690|TK1151|cDNA

GTGATATTTTTAGAGCTACTCTCTGTTGCACCTTGTTCAAGAAGTCTGTGCAGAAATATATCCTCTGGAGGAAAAAAACACCCTCTTCGTGCACCACCTTTTGTTCATAAGGTGGAAGCTCCTTATTGCCTAATGAGGTTGAGATTAACTCATTCTTCATCTGTTTTCCCTCCATTCCCAGGGGAAGAGAGTTCTATGGGTCAATCATTATCAAGTAGTAGAGATATGGAGATTGAAAGTGACAACAATGATAATTTTAA...

CDS

Download CDS FASTA

507 bp · TkAUNG046690|TK1151|CDS

GTGATATTTTTAGAGCTACTCTCTGTTGCACCTTGTTCAAGAAGTCTGTGCAGAAATATATCCTCTGGAGGAAAAAAACACCCTCTTCGTGCACCACCTTTTGTTCATAAGGTGGAAGCTCCTTATTGCCTAATGAGGTTGAGATTAACTCATTCTTCATCTGTTTTCCCTCCATTCCCAGGGGAAGAGAGTTCTATGGGTCAATCATTATCAAGTAGTAGAGATATGGAGATTGAAAGTGACAACAATGATAATTTTAA...

Protein

Download Protein FASTA

168 aa · TkAUNG046690|TK1151|PROTEIN

VIFLELLSVAPCSRSLCRNISSGGKKHPLRAPPFVHKVEAPYCLMRLRLTHSSSVFPPFPGEESSMGQSLSSSRDMEIESDNNDNFNESTSEYLHYIAFKCGTKVEFRQALNPSVELQCSVEIWFAGEKIGEGDGRTRREAQHQAAKASLMNLVGSAKSGTSSVYREE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG046690`
TK1151 ID	TkAUNG046690
OH-1004 ID	LXL04_002299
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	75.000
Protein coverage (%)	TK1151 85.714 / OH-1004 41.131 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG046690

Location ChrUn:12902759-12904021 (-)

Description Similar to CPL1: RNA polymerase II C-terminal domain phosphatase-like 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21670`	Processively dephosphorylates 'Ser-5' but not 'Ser-2' of the heptad repeats YSPTSPS in the C-terminal domain of the largest RNA polymerase II subunit (RPB1).	Fusion genetic analysis of jasmonate-signalling mutants in Arabidopsis.2002 · DOI: 10.1046/j.0960-7412.2001.01241.x C-terminal domain phosphatase-like family members (AtCPLs) differentially regulate Arabidopsis thaliana abiotic stress signaling, growth, and development.2002 · DOI: 10.1073/pnas.112276199 Repression of stress-responsive genes by FIERY2, a novel transcriptional regulator in Arabidopsis.2002 · DOI: 10.1073/pnas.162111599 Arabidopsis C-terminal domain phosphatase-like 1 and 2 are essential Ser-5-specific C-terminal domain phosphatases.2004 · DOI: 10.1073/pnas.0403174101 CTD phosphatases in the attenuation of wound-induced transcription of jasmonic acid biosynthetic genes in Arabidopsis.2009 · DOI: 10.1111/j.1365-313x.2008.03663.x The arabidopsis RNA binding protein with K homology motifs, SHINY1, interacts with the C-terminal domain phosphatase-like 1 (CPL1) to repress stress-inducible gene expression.2013 · DOI: 10.1371/journal.pgen.1003625 The RNA-binding protein HOS5 and serine/arginine-rich proteins RS40 and RS41 participate in miRNA biogenesis in Arabidopsis.2015 · DOI: 10.1093/nar/gkv751 The RNA Polymerase II C-Terminal Domain Phosphatase-Like Protein FIERY2/CPL1 Interacts with eIF4AIII and Is Essential for Nonsense-Mediated mRNA Decay in Arabidopsis.2016 · DOI: 10.1105/tpc.15.00771

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002299 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0006086 pyruvate decarboxylation to acetyl-CoA Biological Process

GO:0006103 2-oxoglutarate metabolic process Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009611 response to wounding Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0034244 negative regulation of transcription elongation by RNA polymerase II Biological Process

KEGG gene cross-reference

ath:AT3G16950

ath:AT4G16155

ath:AT4G21670

ath:AT5G01270

syn:slr1096

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.564

Rank 1 · TkAUNG046690 · TK1151

Cytoplasm0.414

Rank 2 · TkAUNG046690 · TK1151

Mitochondrion0.070

Rank 3 · TkAUNG046690 · TK1151

Cell membrane0.066

Rank 4 · TkAUNG046690 · TK1151

Endoplasmic reticulum0.050

Rank 5 · TkAUNG046690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00035dsrm117-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG046690	`PF00035`	dsrm	117	152	1.8e-06	29.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5YDB6`	Arabidopsis thaliana	sp\|Q5YDB6\|CPL1_ARATH RNA polymerase II C-terminal domain phosphatase-like 1	45.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card