TkAUNG042150 | RubberDandelionOmics

Gene overview

TkAUNG042150

Reference: TK1151 Chr: ChrUn Coordinates: 11720265-11723432 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1835 bp · TkAUNG042150|TK1151|cDNA

GATATTGATTTCAACACGATCCCTTGATAGTGCTATATGATCATGTCATAGCTGAGTATGAGCCAGACAATGATTTACTAGATCAAGAATTCATGCTTAAAGGGAAATGGTTTCAAAGAAAAGATTTAGAGATTGTAAATAGCCGAGGAGACACTCTTCAGTGTAGTCATTACTTGCCTATTGTGAGTCCAGAAGGAAAGCCTCTGCCATGTGTAATCTACTGCCATGGAAACAGTGGATGTAGAGCAGATGCTAGTGAA...

CDS

Download CDS FASTA

1131 bp · TkAUNG042150|TK1151|CDS

ATGGGTGCTGTAACTAGCCTGATGTATGGAGCTGAGGACCCTTCAATTGCTGGCATGGTTCTTGATAGCCCCTTCTCAGATTTGGTTGATTTAATGATGGAACTTGTTGATACCTATAAAATCCGTCTGCCCAAGTTCACTGTTAAATTTGCTATCCAGTACATGAGAAGGGCTATTCTAAAAAAGGCAAAATTTGACATTGTGGAGCTTAATACCATTAAAGTTGCAAAATCATCCTTTGTTCCTGTTCTCTTTGGTCA...

Protein

Download Protein FASTA

376 aa · TkAUNG042150|TK1151|PROTEIN

MGAVTSLMYGAEDPSIAGMVLDSPFSDLVDLMMELVDTYKIRLPKFTVKFAIQYMRRAILKKAKFDIVELNTIKVAKSSFVPVLFGHAGDDDFIQPHHSDRIFDAYMGDKNIIKFEGDHNSPRPQFYFDSINIFFHNVLQPPEDEVKGNFFDTPLDYLSKGIHGVGYEDDFQITPQASSSTEDAINQLRSKRPMSRTDVPSDLPLTDIPCSSEEEGTTTKPVPSSSKMIDFDFSNGHPHGPSVLEDHEYVEYPLEHIEGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG042150`
TK1151 ID	TkAUNG042150
OH-1004 ID	LXL04_019363
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	62.600
Protein coverage (%)	TK1151 100.000 / OH-1004 72.968 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG042150`
Location	ChrUn:11720265-11723432 (-)
Description	Similar to yqkD: Uncharacterized protein YqkD (Bacillus subtilis (strain 168)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019363` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002084 protein depalmitoylation Biological Process GO:0005737 cytoplasm Cellular Component GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0008474 palmitoyl-(protein) hydrolase activity Molecular Function
KEGG gene cross-reference	bsu:BSU23640 dre:561333 gga:418763 mmu:68904 xla:432053 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.316

Rank 1 · TkAUNG042150 · TK1151

Cytoplasm0.306

Rank 2 · TkAUNG042150 · TK1151

Golgi apparatus0.242

Rank 3 · TkAUNG042150 · TK1151

Cell membrane0.195

Rank 4 · TkAUNG042150 · TK1151

Nucleus0.155

Rank 5 · TkAUNG042150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12146Hydrolase_41-32 aa

PF12146Hydrolase_477-113 aa

PF29052PGA28-like_dom262-355 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG042150	`PF12146`	Hydrolase_4	1	32	0.0098	16.0
TkAUNG042150	`PF12146`	Hydrolase_4	77	113	0.0098	16.0
TkAUNG042150	`PF29052`	PGA28-like_dom	262	355	0.64	10.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card