TkAUNG040930 | RubberDandelionOmics

Gene overview

TkAUNG040930

Reference: TK1151 Chr: ChrUn Coordinates: 11409698-11412897 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1641 bp · TkAUNG040930|TK1151|cDNA

CTACCAAAGTTCAACGAATGAGTCTCTTTTGAAAGTAAGCGGTTAGAAATGCGAATTCAAAGAACTTTTAGGTAACAAAAGTAGTGTAGTGTCAATGGTGAAAGTGACGGTGGAAAAGAAATGAGAAGTGGATCAATTGCGTTCTTGTCCACAACTCTGCCTTCTTATACTTCGCCGATAAATCTCACAGCTCTTAGATCATCGGCTGTTTGTCGCTCTGCGTCAGTCGTAGCTTTCCGTCGTCTATCTGTATTTTGCAG...

CDS

Download CDS FASTA

1176 bp · TkAUNG040930|TK1151|CDS

ATGAGAAGTGGATCAATTGCGTTCTTGTCCACAACTCTGCCTTCTTATACTTCGCCGATAAATCTCACAGCTCTTAGATCATCGGCTGTTTGTCGCTCTGCGTCAGTCGTAGCTTTCCGTCGTCTATCTGTATTTTGCAGCTTTCCGGCACGGCAAACTGATAGTCAAGTCAACAAATTTATCCCTTTTCACAATCTATTCAACCTCACTCCTTCCCGCCGTACAGTCACTCGTGCTTCAGCATCAACCATGGCGTCTTC...

Protein

Download Protein FASTA

391 aa · TkAUNG040930|TK1151|PROTEIN

MRSGSIAFLSTTLPSYTSPINLTALRSSAVCRSASVVAFRRLSVFCSFPARQTDSQVNKFIPFHNLFNLTPSRRTVTRASASTMASSFSPEKARVPPAVELPVPPISKFKIGLCQLSVTADKERNIAHARVAIQEAAEKGAKLVLLPEIWNSPYSNDSFPVYAEDIDAGKDSSPSTAMLSEVARSLKITIVGGSIPERCGDKLYNTCCVFDADGKLIAKHRKIHLFDINIPGQITFEESKTLTAGETPTVVDTDVGRIGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG040930`
TK1151 ID	TkAUNG040930
OH-1004 ID	LXL04_003070
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG040930

Location ChrUn:11409698-11412897 (+)

Description Similar to NLP3: Omega-amidase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12040`	Omega-amidase involved in the metabolism of asparagine.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003070 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006107 oxaloacetate metabolic process Biological Process

GO:0006108 malate metabolic process Biological Process

GO:0006528 asparagine metabolic process Biological Process

GO:0006541 glutamine metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0070062 extracellular exosome Cellular Component

KEGG gene cross-reference

ath:AT5G12040

bta:520620

hsa:56954

rno:288174

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.745

Rank 1 · TkAUNG040930 · TK1151

Mitochondrion0.270

Rank 2 · TkAUNG040930 · TK1151

Cytoplasm0.143

Rank 3 · TkAUNG040930 · TK1151

Nucleus0.056

Rank 4 · TkAUNG040930 · TK1151

Peroxisome0.046

Rank 5 · TkAUNG040930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23514YhiY10-32 aa

PF00795CN_hydrolase110-362 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG040930	`PF23514`	YhiY	10	32	0.3	11.6
TkAUNG040930	`PF00795`	CN_hydrolase	110	362	9.2e-66	222.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RUF8`	Arabidopsis thaliana	sp\|Q8RUF8\|NILP3_ARATH Omega-amidase, chloroplastic	74.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card