TkAUNG032300 | RubberDandelionOmics

Gene overview

TkAUNG032300

Reference: TK1151 Chr: ChrUn Coordinates: 8625103-8629177 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2298 bp · TkAUNG032300|TK1151|cDNA

GTTGAGGTTCTGTGTGACGAGGCCAGCAGAGTGAAACCGAGTCGTCAATGGAAAAGAACCCGAGTGAATATCTACGAGTAACCCACCATGATTCCGACCGAATCGCCCGACTCAGCATCCCTCCTCAACAGCCTCAAGCCCTTCACAGCTTCTACGAGGAGTTCAACCTCAGAGGTATACGACTCGATCGATTTCAACCCGGTTTCGTCTCTTGCTCCTTCACAGTCCCCCCTCGCCTTACCGACAGGAATGGAAATCTG...

CDS

Download CDS FASTA

1572 bp · TkAUNG032300|TK1151|CDS

ATGAATTATCCGGCGGCGGTCAATCGACCGGTCCGTTTATCTCCGGCAACCAGTTTTCAGAACCCTAGAAGAATCAAAAACATCAAATTACCTCGCCGTTTGGATAAATCTTCATCCTGTACTACATCGACTCTCACCACCTCCGCTACTTCCAAAAGAATCGACTTTCAACACGAAGGATATAGACTTTGGAGTACTTCTCGTTTGCTTCGAAAACCTAGGGTTTCTTCCGACGATGCTCAGCCTAGTGTTTCCTATGA...

Protein

Download Protein FASTA

523 aa · TkAUNG032300|TK1151|PROTEIN

MNYPAAVNRPVRLSPATSFQNPRRIKNIKLPRRLDKSSSCTTSTLTTSATSKRIDFQHEGYRLWSTSRLLRKPRVSSDDAQPSVSYDECEISEPSFLEFITSERVKVVAMVALALALCNADRVVMSVAVVPLSQSRGWSQSFAGVVQSSFLWGYLISPIAGGTLVDYYGGKVVMACGVALWSMATFLTPWAAENSLLALLTMRALLGVAEGVALPCMNNMIARWFPQTERSRAVGLAMAGFQLGSAIGLTLSPILMSQGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG032300`
TK1151 ID	TkAUNG032300
OH-1004 ID	LXL04_036369
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG032300

Location ChrUn:8625103-8629177 (-)

Description Similar to ANTR4: Probable anion transporter 4, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46980`	Inorganic phosphate and probable anion transporter.	No verified direct reference in this release
`At2g38060`	Inorganic phosphate and probable anion transporter.	No verified direct reference in this release
`At4g00370`	Inorganic phosphate and probable anion transporter.	AtPHT4;4 is a chloroplast-localized ascorbate transporter in Arabidopsis.2015 · DOI: 10.1038/ncomms6928

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0852200`	Probable anion transporter.	No verified direct reference in this release
`Os05g0451100`	Probable anion transporter.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036369 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006811 monoatomic ion transport Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

GO:0015229 L-ascorbic acid transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G38060

ath:AT3G46980

dosa:Os01g0852200

dosa:Os05g0451100

dosa:Os09g0570400

osa:4324813

osa:4338960

osa:4347913

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.958

Rank 1 · TkAUNG032300 · TK1151

Mitochondrion0.031

Rank 2 · TkAUNG032300 · TK1151

Peroxisome0.022

Rank 3 · TkAUNG032300 · TK1151

Golgi apparatus0.018

Rank 4 · TkAUNG032300 · TK1151

Endoplasmic reticulum0.017

Rank 5 · TkAUNG032300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07690MFS_1112-477 aa

PF03137OATP153-187 aa

PF03137OATP213-246 aa

PF03137OATP265-385 aa

PF03137OATP406-450 aa

PF07690MFS_1463-508 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG032300	`PF07690`	MFS_1	112	477	9.8e-49	166.8
TkAUNG032300	`PF03137`	OATP	153	187	0.0013	17.9
TkAUNG032300	`PF03137`	OATP	213	246	0.0013	17.9
TkAUNG032300	`PF03137`	OATP	265	385	0.0013	17.9
TkAUNG032300	`PF03137`	OATP	406	450	0.0013	17.9
TkAUNG032300	`PF07690`	MFS_1	463	508	9.8e-49	166.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q66GI9`	Arabidopsis thaliana	sp\|Q66GI9\|ANTR4_ARATH Probable anion transporter 4, chloroplastic	74.500%	Swiss-Prot	High
`Q7XJR2`	Arabidopsis thaliana	sp\|Q7XJR2\|ANTR3_ARATH Probable anion transporter 3, chloroplastic	58.100%	Swiss-Prot	High
`Q8GX78`	Arabidopsis thaliana	sp\|Q8GX78\|ANTR2_ARATH Ascorbate transporter, chloroplastic	41.900%	Swiss-Prot	Medium
`Q8W0H5`	Oryza sativa subsp. japonica	sp\|Q8W0H5\|PHT43_ORYSJ Probable anion transporter 3, chloroplastic	73.500%	Swiss-Prot	High
`Q53WP9`	Oryza sativa subsp. japonica	sp\|Q53WP9\|PHT42_ORYSJ Probable anion transporter 2, chloroplastic	54.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card