TkAUNG023010 | RubberDandelionOmics

Gene overview

TkAUNG023010

Reference: TK1151 Chr: ChrUn Coordinates: 6189413-6193252 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2976 bp · TkAUNG023010|TK1151|cDNA

ATGCAGTCGACTCCCAAGGAGAGGTTAGTCAACGTGAGGCAAGACAAAGCGGAGCCTCTGAAGTCATACCTGGACCGCTTCAACAAACTGGTCCTCGGCATGGAACAGGTGTCGGACGATGTCATCCTTATGGCTGTCATGACCGGATTGAGGCCCCGGACCAGATTTTGGTGGTCCGTCCACGAAGAAGGGCCGAGAACATACCACGACTTCCTCAACCGTGCAGAACGGTATATAGGGGCTGAGGAAGCCATTCCAGA...

CDS

Download CDS FASTA

2976 bp · TkAUNG023010|TK1151|CDS

ATGCAGTCGACTCCCAAGGAGAGGTTAGTCAACGTGAGGCAAGACAAAGCGGAGCCTCTGAAGTCATACCTGGACCGCTTCAACAAACTGGTCCTCGGCATGGAACAGGTGTCGGACGATGTCATCCTTATGGCTGTCATGACCGGATTGAGGCCCCGGACCAGATTTTGGTGGTCCGTCCACGAAGAAGGGCCGAGAACATACCACGACTTCCTCAACCGTGCAGAACGGTATATAGGGGCTGAGGAAGCCATTCCAGA...

Protein

Download Protein FASTA

991 aa · TkAUNG023010|TK1151|PROTEIN

MQSTPKERLVNVRQDKAEPLKSYLDRFNKLVLGMEQVSDDVILMAVMTGLRPRTRFWWSVHEEGPRTYHDFLNRAERYIGAEEAIPEDMAPEREKRPERREERREERRKPMKPFRPATNFRAFQPGGPGQVTEILTVAPSQVLTEIKDKNLLPEPRPMRADPHCLNQNKYCKYHKAKGHDTDKCWALLAELMKLIDQGQLKKYVNGQQGQGAQQAVAPPPPPPNGAAREIHTLINNSFGEQRESKRARKGQVREARNAYQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG023010`
TK1151 ID	TkAUNG023010
OH-1004 ID	LXL04_019191
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	32.300
Protein coverage (%)	TK1151 82.442 / OH-1004 55.530 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG023010`
Location	ChrUn:6189413-6193252 (+)
Description	Similar to pol: Retrovirus-related Pol polyprotein from transposon opus
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019191` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0006313 DNA transposition Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0042575 DNA polymerase complex Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function
KEGG gene cross-reference	sce:YIL082W-A These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.745

Rank 1 · TkAUNG023010 · TK1151

Nucleus0.309

Rank 2 · TkAUNG023010 · TK1151

Cell membrane0.091

Rank 3 · TkAUNG023010 · TK1151

Mitochondrion0.074

Rank 4 · TkAUNG023010 · TK1151

Endoplasmic reticulum0.059

Rank 5 · TkAUNG023010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19317Gag_p24_C6-31 aa

PF19317Gag_p24_C67-82 aa

PF13975gag-asp_proteas280-319 aa

PF13650Asp_protease_2281-324 aa

PF04320YggL_50S_bp293-306 aa

PF04320YggL_50S_bp400-427 aa

PF00078RVT_1520-672 aa

PF13975gag-asp_proteas551-568 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG023010	`PF19317`	Gag_p24_C	6	31	0.0088	16.4
TkAUNG023010	`PF19317`	Gag_p24_C	67	82	0.0088	16.4
TkAUNG023010	`PF13975`	gag-asp_proteas	280	319	0.19	13.1
TkAUNG023010	`PF13650`	Asp_protease_2	281	324	0.11	14.0
TkAUNG023010	`PF04320`	YggL_50S_bp	293	306	0.033	15.8
TkAUNG023010	`PF04320`	YggL_50S_bp	400	427	0.033	15.8
TkAUNG023010	`PF00078`	RVT_1	520	672	2.9e-22	80.2
TkAUNG023010	`PF13975`	gag-asp_proteas	551	568	0.19	13.1
TkAUNG023010	`PF04320`	YggL_50S_bp	624	683	0.033	15.8
TkAUNG023010	`PF17919`	RT_RNaseH_2	719	815	1.5e-22	80.3
TkAUNG023010	`PF19317`	Gag_p24_C	720	733	0.0088	16.4
TkAUNG023010	`PF17917`	RT_RNaseH	745	820	3.4e-12	47.2
TkAUNG023010	`PF13650`	Asp_protease_2	910	932	0.11	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card