TkAUNG013100 | RubberDandelionOmics

Gene overview

TkAUNG013100

Reference: TK1151 Chr: ChrUn Coordinates: 3333071-3337787 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2670 bp · TkAUNG013100|TK1151|cDNA

CACTTTTCCATCGATCGCATCATGATCCATCAAGAACGAAAGAAAAGACAAAACCCTACTCCTGTCACCCTTTTTAGTATATGTCCACTCTTGGACCCATTAATGGCATGTGGTGGGTGTGGCCAATTTCAACGTCAACTGAGATTACTTCCCCACAATTCCGATTCGATTCATACGCCGCCCGTCGTTTATTAACCAGATGAATCACAATCCGTCGAACAATTTTGATCGTAAGTGTGTTTATTTCACTGCGTAGAAGA...

CDS

Download CDS FASTA

1845 bp · TkAUNG013100|TK1151|CDS

ATGGTGGATGTTCATCAAGAGCGACCTGAATTACCAACAACACTTGACATGCTTGATACAAAAAAGGAGCTTTCTTCTGATGCCATGAAGAGAATTAGCGATTGGATTTGTTCCCAAGAGATCCCAAGCGATGTCACGGTTTCTGTTAGCGGTGTTTCTTTTTCAATACATAAGTTTCCTTTAGTCTCAAAGTGTGGATACATAAAGAAACTATTATCAGACCCCAAACATGCCGATCTTTCTGTAGTGGAAATCCTAGA...

Protein

Download Protein FASTA

614 aa · TkAUNG013100|TK1151|PROTEIN

MVDVHQERPELPTTLDMLDTKKELSSDAMKRISDWICSQEIPSDVTVSVSGVSFSIHKFPLVSKCGYIKKLLSDPKHADLSVVEILEIPGGPEGFELATKFCYDTDIQLSTDNIAMARCVAEYLEMTEDYATGNLVSVTESYLNESGFKNLSTAVSILQSAANFLPISEKVKLIDRCIDTIAFMVTGERSNDGLNSLSHGRSVVDWWAEDLIVLRIDLFKRVLLALVKKGFKQFALGPVLMLYAQKCLRGLEIFGKSKKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG013100`
TK1151 ID	TkAUNG013100
OH-1004 ID	LXL04_036778
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	41.300
Protein coverage (%)	TK1151 84.853 / OH-1004 87.914 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG013100

Location ChrUn:3333071-3337787 (-)

Description Similar to At5g48800: BTB/POZ domain-containing protein At5g48800

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67385`	Acts as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (Probable).	No verified direct reference in this release
`At3g49970`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g48800`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`UniProt: Q682S0`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release
`At1g03010`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036778 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G03010

ath:AT2G47860

ath:AT3G08570

ath:AT3G08660

ath:AT5G48800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.432

Rank 1 · TkAUNG013100 · TK1151

Cytoplasm0.422

Rank 2 · TkAUNG013100 · TK1151

Cell membrane0.195

Rank 3 · TkAUNG013100 · TK1151

Endoplasmic reticulum0.053

Rank 4 · TkAUNG013100 · TK1151

Golgi apparatus0.038

Rank 5 · TkAUNG013100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651BTB39-128 aa

PF03000NPH3205-454 aa

PF12808Mto2_bdg512-536 aa

PF07989Cnn_1N515-546 aa

PF14916CCDC92516-537 aa

PF12808Mto2_bdg537-544 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG013100	`PF00651`	BTB	39	128	7.3e-07	30.1
TkAUNG013100	`PF03000`	NPH3	205	454	1.5e-81	274.6
TkAUNG013100	`PF12808`	Mto2_bdg	512	536	0.025	15.6
TkAUNG013100	`PF07989`	Cnn_1N	515	546	0.0041	18.0
TkAUNG013100	`PF14916`	CCDC92	516	537	0.033	14.7
TkAUNG013100	`PF12808`	Mto2_bdg	537	544	0.025	15.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q66GP0`	Arabidopsis thaliana	sp\|Q66GP0\|SR1P1_ARATH BTB/POZ domain-containing protein SR1IP1	56.500%	Swiss-Prot	High
`Q9SN21`	Arabidopsis thaliana	sp\|Q9SN21\|Y3997_ARATH Putative BTB/POZ domain-containing protein At3g49970	50.000%	Swiss-Prot	High
`Q9FKB6`	Arabidopsis thaliana	sp\|Q9FKB6\|Y5880_ARATH BTB/POZ domain-containing protein At5g48800	38.700%	Swiss-Prot	Medium
`Q682S0`	Arabidopsis thaliana	sp\|Q682S0\|RPT2_ARATH Root phototropism protein 2	35.700%	Swiss-Prot	Medium
`Q9SA69`	Arabidopsis thaliana	sp\|Q9SA69\|Y1301_ARATH BTB/POZ domain-containing protein At1g03010	35.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card